View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_13 (Length: 355)
Name: NF19582_low_13
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 93 - 347
Target Start/End: Original strand, 32819008 - 32819262
Alignment:
| Q |
93 |
cctcggttgatccatttgtaatttcagatcatttccttgagttttgcaactcggcaggtatctctaaaaagcggcgagccttaatgcatttgatttggtt |
192 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32819008 |
cctcgattgatccatttgtaatttcggatcatttccttgagttttgcaactcgccaggtatctctaaaaagcggcgagccttaatgcatttgatttagtt |
32819107 |
T |
|
| Q |
193 |
tgttgatgtttgaattatttgaaatgaaaggaatagcacgatttataaaaacaaggagcatgcatttactcagcttctagatacagttaaacttccttct |
292 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
32819108 |
cgttgatgtttgaattatttggaatgaaaggaatagcatgatttttaaaaataaggagcatgcatttactcagcttctagacacagttaaacttctttct |
32819207 |
T |
|
| Q |
293 |
tttttgtggcttgcaaaattttataattttgttataggttatcatagttgatgat |
347 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32819208 |
tttttgtggctagcaaaattttataattttgttataggttatcatagttggtgat |
32819262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University