View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_16 (Length: 332)
Name: NF19582_low_16
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 7 - 311
Target Start/End: Complemental strand, 42664720 - 42664420
Alignment:
| Q |
7 |
tagattattctctttcgatatcgatacacattcctgaatcaaaattgttatgttgatggacaaaagttgcatcaatattgcacttcaaagtttcattctc |
106 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664720 |
tagattcttctctttcgatatggatacacattcctgtatcaaaattgttatgttgatggacaaaagttgcatcaatattgcacttcaaagtttcattctc |
42664621 |
T |
 |
| Q |
107 |
cgatatttccatccttgatcaactattcatgtgtcagtattttgcatagtagaaaaccatctaattaactcgagttcattttgcaacaattctcatgaag |
206 |
Q |
| |
|
|||| ||||||| ||||||||||||||| ||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42664620 |
cgatttttccattcttgatcaactattcctgtgtcagtattttgtatagtcgaaaaccatctaa----ctcgagttcattttgcaacaattctcatgaag |
42664525 |
T |
 |
| Q |
207 |
tatatacatcccgatgatagtaccgatatttccacattgtcatgtgccttctcgttttgttgcttccagattatcaacagctgcgtcacagattaagaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664524 |
tatatacatcccgatgatagtaccgatatttccacattgtcatgtgccttctcgttttgttgcttccagattatcaacagctgcgtcacagattaagaaa |
42664425 |
T |
 |
| Q |
307 |
gacgt |
311 |
Q |
| |
|
||||| |
|
|
| T |
42664424 |
gacgt |
42664420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University