View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_24 (Length: 268)
Name: NF19582_low_24
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 301563 - 301803
Alignment:
| Q |
18 |
tcaccattacaaaaagcagtaattcttgatctgataaagagtcgtacaatataaaattagctataggggatggtgagtttttcataatcatatctgaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301563 |
tcaccattacaaaaagcagtaattgttgatctgataaagagtcgtacaatataaaattagctataggggatggtgagtttttcataatcatatctgaaat |
301662 |
T |
|
| Q |
118 |
agtctgcagtttatatgtgtactttgtttgggggactgagcagtgattgataaggatttgtcaataagttaggcttctttttcacttaatgtgtcacagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301663 |
agtctgcagtttatatgtgtactttgtttgggggactgagcagtgattgataaggatttgtcaataagttaggcttctttttcacttaatgtgtcacagg |
301762 |
T |
|
| Q |
218 |
aacttttaatttttaaatatgttttcaaaatgagacctatg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
301763 |
aacttttaatttttaaatatgttttcaaaattagacctatg |
301803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University