View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_33 (Length: 231)
Name: NF19582_low_33
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 590241 - 590442
Alignment:
| Q |
15 |
cacagatcaatgaatgggattgattattgcatgcaaggaatcttgatccttacaccaattggagttgaatatggacctacttttctgttacnnnnnnnnn |
114 |
Q |
| |
|
|||| |||||| || | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
590241 |
cacaaatcaataaacgagattgattattgcgtgcaaggaatcttgatccttacaccaattggagttgaatatggacctacttttctgttacttttttctt |
590340 |
T |
 |
| Q |
115 |
nnncggataaatttgattgaaatgattatgtgttagccttactctgaataaactggcgattttgagtttacgtctacataagctttgaggttttgtttgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
590341 |
tttcggataaatttgattgaaatgattatgtgttagccttactctgaataaactggcgattttgagtttacgtctacataagctttgaggttttgtttgt |
590440 |
T |
 |
| Q |
215 |
tg |
216 |
Q |
| |
|
|| |
|
|
| T |
590441 |
tg |
590442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University