View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_34 (Length: 225)
Name: NF19582_low_34
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 60 - 216
Target Start/End: Original strand, 42666196 - 42666355
Alignment:
| Q |
60 |
gtgtgtcaatggtggaagcannnnnnngggtcgaagcatattcaactttcattttcattcattcaacaaatgaatcgagttaggnnnnnnngtttagagt |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
42666196 |
gtgtgtcaatggtggaagcatttttttcggtcgaagcatattcaactttcattttcattcattcaccaaatgaatcgagttaggtttttttgtttagagt |
42666295 |
T |
 |
| Q |
160 |
gagtgaaactactcaagtcaaaattctt---ttcttcttcttctacttcctcttcatctc |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
42666296 |
gagtgagactactcaagtcaaaattcttttcttcttcttcttctacttcctcttcttctc |
42666355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University