View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19582_low_35 (Length: 220)

Name: NF19582_low_35
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19582_low_35
NF19582_low_35
[»] chr1 (1 HSPs)
chr1 (19-210)||(25810964-25811155)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 25811155 - 25810964
Alignment:
19 attgattcataaggagttaggatcatggtactgaaggagtaatcttgttgtaatcatgcattaaaacaaataaatttgcaacatgcatannnnnnngttc 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       ||||    
25811155 attgattcataaggagttaggatcatggtactgaaggagtaatcttgttgtaatcatgcattcaaacaaataaatttgcaacatgcatatttttttgttc 25811056  T
119 atatcaataaagtactataacttttgggttaaactcgggtccacatataacatctgtgggttgagttgagttgagtaggtgttcttctctct 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
25811055 atatcaataaagtactataacttttgggttaaactcgggtccacatataacatctgtgggttgagttgagttgagtaggtgttcttttctct 25810964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University