View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19582_low_40 (Length: 204)
Name: NF19582_low_40
Description: NF19582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19582_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 40892968 - 40893153
Alignment:
| Q |
1 |
ggaatttgtgtttaaattgatgatcatagtcgcttgaattggccggaaccttcttctaagattgtatttatgttgataaccatgctagtatatggtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40892968 |
ggaatttgtgtttaaattgatgatcatagtcgcttgaattggccggaaccttcttctaagattgtatttatgttgataaccatgctagtatatggtttct |
40893067 |
T |
 |
| Q |
101 |
gttgactcatcctacaatgaaatgaaaatggtacaaacacctaaatacaagagtaaggtggtggtagtgtacctcttcaaaaaagg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40893068 |
gttgactcatcctacaatgaaatgaaaatggtacaaacacctaaatacaagagtaaggtggtggtagtgtacctcttcaaaaaagg |
40893153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 53 - 139
Target Start/End: Original strand, 44144533 - 44144622
Alignment:
| Q |
53 |
cttctaagattgtatttatgttgataaccatgct---agtatatggtttctgttgactcatcctacaatgaaatgaaaatggtacaaaca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44144533 |
cttctaagattgtatttatgttgataaccatgctgctagtatatggtttctgttgactcatcctacaatgaaatgaaaatggtagaaaca |
44144622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 44144455 - 44144510
Alignment:
| Q |
1 |
ggaatttgtgtttaaattgatgatcatagtcgcttgaattggccggaaccttcttc |
56 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44144455 |
ggaatttgtgattaaattgatgatcatagttacttgaattggccggaaccttcttc |
44144510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 44144656 - 44144706
Alignment:
| Q |
133 |
acaaacacctaaatacaagagtaaggtggtggtagtgtacctcttcaaaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44144656 |
acaaacacctaaatacaagagtaaggtggtggtagtgtacaccttcaaaaa |
44144706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University