View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_18 (Length: 428)
Name: NF19583_high_18
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Complemental strand, 47126958 - 47126551
Alignment:
| Q |
1 |
acaagaatcgatctcatacaatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126958 |
acaagaatcgatctcatacaatcttgcaccattattatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacc |
47126859 |
T |
 |
| Q |
101 |
taccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattcttaaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126858 |
taccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattcttaaaaac |
47126759 |
T |
 |
| Q |
201 |
aatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttgggcagacagtagaccct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47126758 |
aatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtctaggcattcgactgaagaggtttatcttggacagacagtagaccct |
47126659 |
T |
 |
| Q |
301 |
gattggactgcagacgctgaaccattggcagcatttaggcgattttcacagaagctactggagattgagaataatatcatgaaaaggaacaaagacccaa |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47126658 |
gattggactgcagacgctgaaccattggcagcatttaggcgattttcacagaagctactggagattgagaataatatcatgaaaaggaacaaggacccaa |
47126559 |
T |
 |
| Q |
401 |
gtttgaag |
408 |
Q |
| |
|
|||||||| |
|
|
| T |
47126558 |
gtttgaag |
47126551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 9606270 - 9606339
Alignment:
| Q |
29 |
ccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggtta |
98 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| || ||||||||||| ||||||| |||||| |
|
|
| T |
9606270 |
ccattatcatatggactgcttctgctcttcatgcagctgttaattttggacaatatccttatggaggtta |
9606339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 46709234 - 46709155
Alignment:
| Q |
37 |
atatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacctaccaaatcgtccaac |
116 |
Q |
| |
|
|||||| | ||||| ||| | ||||||||||| |||||||||||||| |||| |||||||||| |||||| |||||||| |
|
|
| T |
46709234 |
atatggattgcttcagctctacatgcagctgtaaactttggacaatatccttttgcaggttactcaccaaaccgtccaac |
46709155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 6456223 - 6456151
Alignment:
| Q |
19 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatg |
91 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||| |||||||||| || ||||||||||| || ||||||| |
|
|
| T |
6456223 |
caatcttgctccattatcatatggactgcttcagctcttcatgcagcagttaactttggacagtatccttatg |
6456151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 6449756 - 6449686
Alignment:
| Q |
19 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaataccctta |
89 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| ||||||||||||| || || |||||||| ||||| |
|
|
| T |
6449756 |
caatcttgctccattattatatggactgcttctgctcttcatgcagctgttaatttcggacaatatcctta |
6449686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 7458044 - 7457984
Alignment:
| Q |
23 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
83 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7458044 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7457984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 7470446 - 7470386
Alignment:
| Q |
23 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
83 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7470446 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7470386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University