View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_22 (Length: 374)
Name: NF19583_high_22
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 20 - 278
Target Start/End: Original strand, 26500133 - 26500392
Alignment:
| Q |
20 |
agtgtgaggttcagggtggacaagctgcagccacacccacacaccctttgcctgagggcactctctcaaaacatggatgcttgattcagtcacggtccag |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26500133 |
agtgtgagggtcagggtggacaagctgcagccacacccacacaccctttgcctgagggcactctctcaaaacatggatgcttgattcagtcacggtccag |
26500232 |
T |
|
| Q |
120 |
caatgtgagcaataaggattgccaaggctcattttactctttcgttgatttatctgcaatctgtcatgcataagaagcc-nnnnnnntgtatatggattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
26500233 |
caatgtgagcaataaggattgccaagactcattttactctttcgttgatttatctgcaatctgtcaggcataagtagccaaaaaaaatgtatatggattg |
26500332 |
T |
|
| Q |
219 |
ttgcatacataattatgacactctctaaaggagcaatccattgtatgcagatttggataa |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26500333 |
ttgcatacataactatgacactctctaaaggagcaatccattgtatgcagatttggataa |
26500392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 246 - 346
Target Start/End: Original strand, 26491226 - 26491326
Alignment:
| Q |
246 |
aaggagcaatccattgtatgcagatttggataaggcagttcctaatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggtggtgctt |
345 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491226 |
aaggagcaatcctttgtacgcagatttggataaggcagttcctgatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggtggtgctt |
26491325 |
T |
|
| Q |
346 |
a |
346 |
Q |
| |
|
| |
|
|
| T |
26491326 |
a |
26491326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 246 - 338
Target Start/End: Original strand, 26503663 - 26503755
Alignment:
| Q |
246 |
aaggagcaatccattgtatgcagatttggataaggcagttcctaatgagcataagaaatttcttgcaaatttggtttgggttcatgaagaggt |
338 |
Q |
| |
|
|||||||| | ||||| |||||||||||| ||||||||||||| ||||||||||||||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
26503663 |
aaggagcagttcattgcatgcagatttggttaaggcagttcctgatgagcataagaaatttctcgcgaatttggtttgggtgcatgaagaggt |
26503755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 346
Target Start/End: Original strand, 26487961 - 26488006
Alignment:
| Q |
301 |
aaatttcttgcaaatttggtttgggttcatgaagaggtggtgctta |
346 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26487961 |
aaatttctcgcaaatttggtttgggttcatgaagaggtggtgctta |
26488006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University