View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_27 (Length: 339)
Name: NF19583_high_27
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 124 - 317
Target Start/End: Complemental strand, 29816707 - 29816514
Alignment:
| Q |
124 |
aattgggatatgagttgtgtgctctcacaatcccgtagccacatatatgtcgttggattaaaattggacggttcatatgcggctgagtacgtgcgatcac |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| || |||||||| |||||||| |||||| | ||||| |||| |
|
|
| T |
29816707 |
aattgggatatgagttgtgtgctgtcacaatcccgtagccacgtctatgtcgttggatcaagattggacgattcatatggggctgactgcgtgcagtcac |
29816608 |
T |
|
| Q |
224 |
actgtacacggttgagatgcaaacaattttccatgatttcaaaatctattgagtcaaaataaattaatgctagcaccccaataaaggaaaaaag |
317 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
29816607 |
actgtacacggttgaaatcccaacaattttccatgatttcaaaatcactagagtcaaaataaattaatcctagcaccccaagaaaggaaaaaag |
29816514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 29818221 - 29818172
Alignment:
| Q |
5 |
gtgtcagctcctccacaaaaggcttctctggctctgatgttgctggttga |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29818221 |
gtgtcagctcctccacaaaaggcttctctggctctgatgttgctggttga |
29818172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University