View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_39 (Length: 293)
Name: NF19583_high_39
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 171 - 265
Target Start/End: Complemental strand, 33208418 - 33208323
Alignment:
| Q |
171 |
attaaaggagtattatataagataaacatctatttagggtagaaatttctttga-catagggaaaaagtttcttttaccatccatataaggaccta |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
33208418 |
attaaaggagtattatataagataaacatctatttagggtagaaatttctttgaccatagggaaaaagtttcttttaccatctatttaaggaccta |
33208323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University