View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_46 (Length: 281)
Name: NF19583_high_46
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 138 - 243
Target Start/End: Complemental strand, 46002345 - 46002240
Alignment:
| Q |
138 |
catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgattcgatattatggtttttgaaatattccttcaatgtattta |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002345 |
catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgatttgatattatggtttttgaaatattccttcaatgtattta |
46002246 |
T |
|
| Q |
238 |
cctgaa |
243 |
Q |
| |
|
|||||| |
|
|
| T |
46002245 |
cctgaa |
46002240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 46002464 - 46002427
Alignment:
| Q |
15 |
gattatactgtcggatggttgcaccggttcaactaatt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002464 |
gattatactgtcggatggttgcaccggttcaactaatt |
46002427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University