View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_53 (Length: 242)
Name: NF19583_high_53
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_53 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 37203998 - 37203757
Alignment:
| Q |
1 |
ctaggacatcatctatttgtagcaccataaatgttgcatttaatccaatgatttaaaggaggccgccatacaacttctttaatcctaggcacaataggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37203998 |
ctaggacatcatctatttgtagcaccataaatgttgcatttaatccaatcatttaaaggaggccgccataaaacttctttaatcctaggcacaataggag |
37203899 |
T |
|
| Q |
101 |
gatgaatgttcgtcggtcgagaaggccttcaaaatatggacacccttaatagaggatgtggtagttgttagagcaagaattattgtcacacatcatcgta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
37203898 |
gatgaatgttcgtcggtcgagaaggccttcaaaatatggacacccttaatagaggatgtggtagttgttagagcaggtattattgtcacacatcatcgta |
37203799 |
T |
|
| Q |
201 |
ttacaaattttacggcaatttaatatctcgattattcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37203798 |
ttacaaattttacggcaatttaatatctcgattattcttctc |
37203757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University