View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_high_55 (Length: 236)
Name: NF19583_high_55
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 9068672 - 9068892
Alignment:
| Q |
1 |
agacactattcaagaaaattagtctgtcgaaaattggatagacgcaccaatatcttcctagtagctcgagtagtattttgtgagaagaaaatactagtat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9068672 |
agacactattcaagaaaattagtttgtcgaaaattggatagacgcaccaatatcttcctagtagctcgagtagtattttgtgagaagaaaataccagtat |
9068771 |
T |
 |
| Q |
101 |
tttcttgacaaaattgccttagaggttttgcgacacaattcatttgcatttatctatcctctcgaaacaagtatatagctcatcagcaaacatcaagtga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9068772 |
tttcttgacataattgccttagaggttttgtgacacaattcatttgcatttatctatcctctcgaaacaagtatagagctcatcagaaaacatcaagtga |
9068871 |
T |
 |
| Q |
201 |
gacaccattggcccaaaacaa |
221 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
9068872 |
gacaccaatggcccaaaacaa |
9068892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University