View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_low_34 (Length: 319)
Name: NF19583_low_34
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 138 - 208
Target Start/End: Original strand, 29815480 - 29815548
Alignment:
| Q |
138 |
gtcttagtccctacattctcttggtgttagtccttataatttacaaaaatgcatgcttctaatcccacttt |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29815480 |
gtcttagtccctacattctcttggt--tagtccatataatttacaaaaatgcatgcttctaattccacttt |
29815548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University