View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19583_low_34 (Length: 319)

Name: NF19583_low_34
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19583_low_34
NF19583_low_34
[»] chr2 (1 HSPs)
chr2 (138-208)||(29815480-29815548)


Alignment Details
Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 138 - 208
Target Start/End: Original strand, 29815480 - 29815548
Alignment:
138 gtcttagtccctacattctcttggtgttagtccttataatttacaaaaatgcatgcttctaatcccacttt 208  Q
    |||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||||||| |||||||    
29815480 gtcttagtccctacattctcttggt--tagtccatataatttacaaaaatgcatgcttctaattccacttt 29815548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University