View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_low_41 (Length: 292)
Name: NF19583_low_41
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 27781642 - 27781374
Alignment:
| Q |
18 |
aattccaccatgttgaactacacatttcttcctccatgaaaacatgagttccgatctttttcataaactaaatatagtccaacagaaataaatgaatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27781642 |
aattccaccatgttgaactacacatttcttcctccatgaaaacatgagttccgatctttttcataaactaaatatagtccaacagaaataaatgaatatg |
27781543 |
T |
 |
| Q |
118 |
ctcacttacaaacttatttgctataatgtcatcaaattgtcatgacttaactaagactcaaacctta---tcatattcatcattgactgcagagtctccg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
27781542 |
ctcacttacaaacttatttgctataatgtcatcaaattgtcatgacttaactaagactcgaaccttatcatcatattcatcgttgactgcagagtctccg |
27781443 |
T |
 |
| Q |
215 |
gtctcgctgttggtttcactaagaagttcatcactagcatctacatctgacccctctattgattcatct |
283 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27781442 |
gtctcgctgttggtttcactaacaagttcatcactagcatctacatctgacccctctattgattcatct |
27781374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University