View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_low_42 (Length: 292)
Name: NF19583_low_42
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 29053036 - 29052770
Alignment:
| Q |
19 |
gaagttcccattgcatttgcaacatcattagcaccaatgttccaagccatgtaaaatccaaacaaaagtgttccatatgataacatctttgtcttcaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29053036 |
gaagttcccattgcatttgcaacatcattagcaccaatgttccaagccatgtaaaatccaaacaaaagtgttccatatgataacatctttgtcttcaatg |
29052937 |
T |
|
| Q |
119 |
ccaaaccttgtcctaaagatgtcataaacaaaggaaaaacaagtgcagccattactatacatattgttatagcagaagctgttcttgatgatatgtgaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052936 |
ccaaaccttgtcctaaagatgtcataaacaaaggaaaaacaagtgcagccattactatacatattgttatagcagaagctgttcttgatgatatgtgaaa |
29052837 |
T |
|
| Q |
219 |
tgctttagccattcctgatacttcatcattattctctccgttttctgttgcagcatgttgatgatgt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29052836 |
tgctttagccattcctgatacttcatcattattctccccgttttctgttgcagcatgttggtgatgt |
29052770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University