View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19583_low_47 (Length: 281)

Name: NF19583_low_47
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19583_low_47
NF19583_low_47
[»] chr1 (2 HSPs)
chr1 (138-243)||(46002240-46002345)
chr1 (15-52)||(46002427-46002464)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 138 - 243
Target Start/End: Complemental strand, 46002345 - 46002240
Alignment:
138 catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgattcgatattatggtttttgaaatattccttcaatgtattta 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
46002345 catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgatttgatattatggtttttgaaatattccttcaatgtattta 46002246  T
238 cctgaa 243  Q
    ||||||    
46002245 cctgaa 46002240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 46002464 - 46002427
Alignment:
15 gattatactgtcggatggttgcaccggttcaactaatt 52  Q
    ||||||||||||||||||||||||||||||||||||||    
46002464 gattatactgtcggatggttgcaccggttcaactaatt 46002427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University