View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_low_61 (Length: 222)
Name: NF19583_low_61
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 2115736 - 2115930
Alignment:
| Q |
9 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccaccaaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115736 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccac-aaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
2115834 |
T |
 |
| Q |
109 |
ctaaaacataaactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctgtataagattgaatcttattttgtatcacaat |
204 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
2115835 |
ctagaacatagactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctgtataagattgaatcttagttagtattacaat |
2115930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 9 - 173
Target Start/End: Original strand, 11873302 - 11873466
Alignment:
| Q |
9 |
acatcatcaactagtgtatgaagcagctgaaagtgaaagaatgcccaccaaggaaatgctatagaatcgggacctttccgttgttcttgtcggtcttttt |
108 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| || ||||||| ||||||||||| ||||| || || |||||||| ||||||||||| || || |||| |
|
|
| T |
11873302 |
acatcatcaattagtgtatgatgcagctgaaaatggaagaatgtccaccaaggaagtgctagagcattgggaccttctcgttgttcttgccgatcctttt |
11873401 |
T |
 |
| Q |
109 |
ctaaaacataaactccttgaaccaagctagcagctactgactttcgatgatatgcatgatccctg |
173 |
Q |
| |
|
| | || ||||| ||||| ||||| |||||||| ||||||||||||| | | |||| ||||||| |
|
|
| T |
11873402 |
ccagaatgtaaacaccttggaccaaactagcagcaactgactttcgattacaagcatcatccctg |
11873466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University