View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19583_low_63 (Length: 221)
Name: NF19583_low_63
Description: NF19583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19583_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 51 - 204
Target Start/End: Original strand, 8621527 - 8621680
Alignment:
| Q |
51 |
agcaaggcttcaccagatcctggtgtgttcttcacacggcttcctctttgtttcgcagacggtgtctcgagatttccaccagcaagaccaacaattggtg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8621527 |
agcaaggcttcaccagatcctggtgtgttcttcacacgacttcctctttgtttcgcagatggtgtctcgagatttccaccagcaagaccaacaattggtg |
8621626 |
T |
 |
| Q |
151 |
aatcatttgtcatgtccatcaatgcacatcgatcttgattttgttgaccctttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8621627 |
aatcatttgtcatgtccatcaatgcacatctatcttgattttgttgaccctttg |
8621680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University