View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19584_low_10 (Length: 263)
Name: NF19584_low_10
Description: NF19584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19584_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 12 - 148
Target Start/End: Original strand, 44407024 - 44407160
Alignment:
| Q |
12 |
aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407024 |
aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag |
44407123 |
T |
 |
| Q |
112 |
tggcattttcattttatgattcaaataaaaccctgtg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407124 |
tggcattttcattttatgattcaaataaaaccctgtg |
44407160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 204 - 263
Target Start/End: Original strand, 44407221 - 44407280
Alignment:
| Q |
204 |
tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407221 |
tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttct |
44407280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University