View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19584_low_10 (Length: 263)

Name: NF19584_low_10
Description: NF19584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19584_low_10
NF19584_low_10
[»] chr2 (2 HSPs)
chr2 (12-148)||(44407024-44407160)
chr2 (204-263)||(44407221-44407280)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 12 - 148
Target Start/End: Original strand, 44407024 - 44407160
Alignment:
12 aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44407024 aatactaacatgtatgtattcagggcaaagccatctcttgctggaaaatttaggataggatagttccagtggcattgatgttattttttgctgaatttag 44407123  T
112 tggcattttcattttatgattcaaataaaaccctgtg 148  Q
    |||||||||||||||||||||||||||||||||||||    
44407124 tggcattttcattttatgattcaaataaaaccctgtg 44407160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 204 - 263
Target Start/End: Original strand, 44407221 - 44407280
Alignment:
204 tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttct 263  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44407221 tttgagattcatacaaacaaaaaattaaaatatgcagaagtttaaagttctattggttct 44407280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University