View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19586_high_11 (Length: 369)
Name: NF19586_high_11
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19586_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 6e-96; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 11078653 - 11078908
Alignment:
| Q |
18 |
agtatcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcgaagaaaggttgattattccttggaaggatattc |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
11078653 |
agtatcatgatatcagtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcaaagaaaggttgatt---ccttggaaggatattc |
11078749 |
T |
|
| Q |
118 |
agaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcaactaaagcatattactgagatggtaccttttgtgtc---tannnnn |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||| |||| || |
|
|
| T |
11078750 |
agaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcagctaaaacatattaccgagatggtaccttttctgtctattattttt |
11078849 |
T |
|
| Q |
215 |
nnatattcatcgtcatttcattttgatgttatttaactcaattttctgacgtagtgaca |
273 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11078850 |
ttatattcatcgtcatttcatttcgatgttatttaactcaattttctgatgtagtgaca |
11078908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 11090021 - 11090267
Alignment:
| Q |
18 |
agtatcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcgaagaaaggttgattattcct---tggaaggata |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| || | ||||| |||||||| | |||||||||| |
|
|
| T |
11090021 |
agtatcatgatataagtgaattcatatattgattgcagaaaggagcaatgaaactagatagcgaccaaagaatggttgattccttggaactggaaggata |
11090120 |
T |
|
| Q |
115 |
ttcagaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcaactaaagcatattactgagatggtaccttttgtgtc--tannn |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |||||||||| || ||||| ||||||||||||||||||| ||||||||| || |
|
|
| T |
11090121 |
ttcagaaggaaaaatatcagagcttaaaaagcatatgaagcaggcatatgaggatcagctaaaacatattactgagatggtactttttgtgtctatattt |
11090220 |
T |
|
| Q |
213 |
nnnnatattcatcgtcatttcattttgatgttatttaactcaatttt |
259 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
11090221 |
ttttatattcatcgtcgtttcatttcgatgttgtttaactcaatttt |
11090267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 11078928 - 11078984
Alignment:
| Q |
285 |
ttggaaatttgtatagtagctatatat----gcattactgcatggtgcataccaact |
337 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
11078928 |
ttggaaatttttatagtagctatatatacatgcattactgcatggtgcatactaact |
11078984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University