View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19586_high_15 (Length: 265)
Name: NF19586_high_15
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19586_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 1786478 - 1786729
Alignment:
| Q |
1 |
tttgtttactcttttcttttcactatgatctttgaagatttaccaaatgaatatgtatacattaggcaagaacaaggtgctttcatggataaagaggcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786478 |
tttgtttactcttttcttttcactatgatctttgaagatttaccaaatgaatatgtatacattaggcaagaacaaggtgctttcatggataaagaggcta |
1786577 |
T |
 |
| Q |
101 |
gaaattgcaattgatagtgctagaggtgtttggtttttgcacacatatgaaggaggctgcattgttcatcgtgacatcaaggtcaatctttattaacatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786578 |
gaaattgcaattgatagtgctagaggtgtttggtttttgcacacatatgaaggaggctgcattgttcatcgtgacatcaaggtcaatctttattaacatc |
1786677 |
T |
 |
| Q |
201 |
ttaaacacattgagtataatgcttagaattgccataaagttgacagaattat |
252 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786678 |
ttaaacaaattgagtacaatgcttagaattgccataaagttgacagaattat |
1786729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University