View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19586_high_16 (Length: 249)

Name: NF19586_high_16
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19586_high_16
NF19586_high_16
[»] chr7 (1 HSPs)
chr7 (113-205)||(42290923-42291015)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 113 - 205
Target Start/End: Complemental strand, 42291015 - 42290923
Alignment:
113 tagtttcctttccaaatataatacatcacctggtcactatgatccaattaattagtcaataaattgtcgtaataacttttgcaaagctttctt 205  Q
    |||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
42291015 tagtttcctttccaaatataatacaatacctggtcactatgatccgattaattagtcaataaattgtcgtaataacttttgcaaagctttctt 42290923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University