View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19586_high_19 (Length: 231)

Name: NF19586_high_19
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19586_high_19
NF19586_high_19
[»] chr2 (1 HSPs)
chr2 (150-231)||(40464099-40464180)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 150 - 231
Target Start/End: Original strand, 40464099 - 40464180
Alignment:
150 ggttatatttttagtctataatagaccatcaaaatttaccaacacatatatgaccaataatatttattagtatctcttatat 231  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
40464099 ggttatatttttagtctataatagaccatcaaaatttaccaaaacatatatgaccaataatatttactagtatctcttatat 40464180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University