View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19586_low_13 (Length: 330)
Name: NF19586_low_13
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19586_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 13 - 322
Target Start/End: Original strand, 40464157 - 40464470
Alignment:
| Q |
13 |
aatatttattagtatctcttatatactaaatcatagtagtgattcactaagttttgaaatgattcacaagtttaatagtggattcagcacccttacattt |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464157 |
aatatttactagtatctcttatatactacatcgtagtagtgattcactaatttttggaatgattcacaagtttaatagtggattcagcacccttacattt |
40464256 |
T |
 |
| Q |
113 |
atagatatacacctagttcacgcggttagaatatcagtgcccatttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaatt |
212 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464257 |
atagagatacccctagttcacgcggttagaatatcagtgcccatttaatcaaatattagaaggtctaaattaaaatttacattttatgaattgtctaatt |
40464356 |
T |
 |
| Q |
213 |
ttgattaaatgactaccaatgttgttacaactgcatg----aatgcggaatcctctaacttcataaatccaaattcgtctatagtcatgcggtttgatca |
308 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40464357 |
ttgattaaacgactgccaatgttgtcacaactgcatgaattaatgcgggatcctctaacttctcaaatccaaattcgtctataatcatgcggtttgatca |
40464456 |
T |
 |
| Q |
309 |
gagactcgctagtt |
322 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40464457 |
aagactcgctagtt |
40464470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University