View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19586_low_15 (Length: 265)

Name: NF19586_low_15
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19586_low_15
NF19586_low_15
[»] chr6 (1 HSPs)
chr6 (1-252)||(1786478-1786729)


Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 1786478 - 1786729
Alignment:
1 tttgtttactcttttcttttcactatgatctttgaagatttaccaaatgaatatgtatacattaggcaagaacaaggtgctttcatggataaagaggcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1786478 tttgtttactcttttcttttcactatgatctttgaagatttaccaaatgaatatgtatacattaggcaagaacaaggtgctttcatggataaagaggcta 1786577  T
101 gaaattgcaattgatagtgctagaggtgtttggtttttgcacacatatgaaggaggctgcattgttcatcgtgacatcaaggtcaatctttattaacatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1786578 gaaattgcaattgatagtgctagaggtgtttggtttttgcacacatatgaaggaggctgcattgttcatcgtgacatcaaggtcaatctttattaacatc 1786677  T
201 ttaaacacattgagtataatgcttagaattgccataaagttgacagaattat 252  Q
    ||||||| |||||||| |||||||||||||||||||||||||||||||||||    
1786678 ttaaacaaattgagtacaatgcttagaattgccataaagttgacagaattat 1786729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University