View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19586_low_19 (Length: 234)

Name: NF19586_low_19
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19586_low_19
NF19586_low_19
[»] chr4 (2 HSPs)
chr4 (18-209)||(11078653-11078841)
chr4 (18-209)||(11090021-11090215)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 11078653 - 11078841
Alignment:
18 agtatcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcgaagaaaggttgattattccttggaaggatattc 117  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||   ||||||||||||||||    
11078653 agtatcatgatatcagtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcaaagaaaggttgatt---ccttggaaggatattc 11078749  T
118 agaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcaactaaagcatattactgagatggtaccttttgtgtcta 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||| ||||||    
11078750 agaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcagctaaaacatattaccgagatggtaccttttctgtcta 11078841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 11090021 - 11090215
Alignment:
18 agtatcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcgaagaaaggttgattattcct---tggaaggata 114  Q
    |||||||||||||  ||||||||||||||| ||||||||||||||||||||||||  |||| || | ||||| ||||||||  |      ||||||||||    
11090021 agtatcatgatataagtgaattcatatattgattgcagaaaggagcaatgaaactagatagcgaccaaagaatggttgattccttggaactggaaggata 11090120  T
115 ttcagaaggacaaatatcagagcttaaaaagcatatgcagcaaacatatgaggagcaactaaagcatattactgagatggtaccttttgtgtcta 209  Q
    |||||||||| |||||||||||||||||||||||||| ||||  |||||||||| || ||||| ||||||||||||||||||| |||||||||||    
11090121 ttcagaaggaaaaatatcagagcttaaaaagcatatgaagcaggcatatgaggatcagctaaaacatattactgagatggtactttttgtgtcta 11090215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University