View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19586_low_21 (Length: 229)
Name: NF19586_low_21
Description: NF19586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19586_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 21536692 - 21536885
Alignment:
| Q |
18 |
gtgattggcggtgctcctgctgccaatgaccgggtgaagaaagtgcttgagatgttgaggaagcgtttgcaacttccctgttctggtggtcagtagagtt |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536692 |
gtgaatggcggtgctcctgctgccaatgaccgggtgaagaaagtgcttgagatgttgaggaagcgtttgcaacttccctgttctggtggtcagtagagtt |
21536791 |
T |
 |
| Q |
118 |
acaaaatgatcatttgaggtattgagctctcaggttctgtttttcttttggagttcatttgaggtatttccctcaaatacatcttaatagtgta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21536792 |
acaaaatgatcatttgaggtattgagctctcaggttctgtttttcttttggagttcatttgaggtatttccctcaaatacatcttaatagtgta |
21536885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 26480231 - 26480187
Alignment:
| Q |
18 |
gtgattggcggtgctcctgctgccaatgaccgggtgaagaaagtg |
62 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26480231 |
gtgattggtggtactcctgctgcaaatgaccgggtgaagaaagtg |
26480187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University