View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19587_high_14 (Length: 376)
Name: NF19587_high_14
Description: NF19587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19587_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 19 - 360
Target Start/End: Complemental strand, 42306374 - 42306033
Alignment:
| Q |
19 |
catagggactatggggattagcggcgtgtcatgagaaacgaggcgaaataggtaaagcactaatctcttttcactcttcctttgaattcatattcttttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306374 |
catagggactatggggattagcggcgtgtgatgagaaacgaggcgaaataggtaaagcactaatctcttttcactcttcctttgaattcatattcttttg |
42306275 |
T |
 |
| Q |
119 |
attcattaacatgtttttcattgaatttttgttgttataggaattgcctttgaagtcaatatcatcttgtttggaattcaagtgtcgaacttgtagattc |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306274 |
attcattaacgtgtttttcattgaatttttgttgttataggaattgcctttgaagtcaatatcatcttgtttggaattcaagtgtcgaacttgtagattc |
42306175 |
T |
 |
| Q |
219 |
atcaacaaattctaaggctcttacgtttactgcttctgcgggacatgtgtatgtctcctatcctattcttcaattttacgtcataagaatttgagataat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42306174 |
atcaacaaattctaaggctcttacgtttactgcttctgctggacatgtgtatgtctcctatcctattcttcaattttacgtcataataatttgagataat |
42306075 |
T |
 |
| Q |
319 |
gacataattcatatataatcacatgatgtgcactgtgacatg |
360 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306074 |
gacatgattcatatataatcacatgatgtgcactgtgacatg |
42306033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University