View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19587_high_17 (Length: 363)
Name: NF19587_high_17
Description: NF19587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19587_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 54 - 349
Target Start/End: Complemental strand, 52955467 - 52955172
Alignment:
| Q |
54 |
aaattctatcaattcacatctcaaattgaattatatatatttccgctaaattctcaaaatatattatctcacannnnnnnaccttcatcttttctaggat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52955467 |
aaattctatcaattcacatctcaaattgaattatatatatttccgctaaattctcacaatatattatctcacatttttttaccttcatcttttctaggat |
52955368 |
T |
|
| Q |
154 |
acttcgatggagcatatatgcgaacgaacacctaccgagtattggcatgtgatacaatagtcaatatgtatatttatgtttatgattcaggcttcataga |
253 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52955367 |
acttcgatggagcatatatgtgaacgaacacctaccgagtattggtatgtgatacaatagtcaatatgtatatttatgtttatgattcaggcttcataga |
52955268 |
T |
|
| Q |
254 |
attcccttccatgcgatggtttttgctgtttttgggacgatgctttagttttcacttggactatattgtgatacttcaaaataaacataatgaagt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52955267 |
attcccttccatgcgatggtttttgctgtttttgggacgatgctttagttttcacttggactatattgggatacttcaaaataaacataatgaagt |
52955172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 52955540 - 52955501
Alignment:
| Q |
18 |
acggagtctcctcaatctcattaacttcatcacaagaaat |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52955540 |
acggagtctcctcaatctcattaacttcatcacaagaaat |
52955501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University