View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19587_low_18 (Length: 342)

Name: NF19587_low_18
Description: NF19587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19587_low_18
NF19587_low_18
[»] chr8 (1 HSPs)
chr8 (275-326)||(3001509-3001560)


Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 3001509 - 3001560
Alignment:
275 ttttcattgagataatattatattggtcttatggacgatattgtattattat 326  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||    
3001509 ttttcattgagataatattatattggtcttatggacgatattatattattat 3001560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University