View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19587_low_19 (Length: 323)
Name: NF19587_low_19
Description: NF19587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19587_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 37 - 311
Target Start/End: Original strand, 32872365 - 32872639
Alignment:
| Q |
37 |
acagcagagactataatagtcaacaacacaaagaagaagacatgacaaacttgnnnnnnntagcatccgttttcaaagggaaatggaaatgagaacagtg |
136 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
32872365 |
acagcagagactacaatagtcaacaacacagagaagaaggcatgacaaagttgaaaaaaatagcatccgttttgaaagggaaatggaaatcagaacagtg |
32872464 |
T |
|
| Q |
137 |
aaggattcagtagaagttcatgaggcttgacttgacataggtgtttgttcgnnnnnnnagtaaaaattcatgaagcaattgaattttgcttgactgattt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32872465 |
aaggattcagtagaagttcatgaggcttgacttgacataggtgtttgttcgtttttttagtaaaaattcatgaagcaattgaattttgcttgactgatat |
32872564 |
T |
|
| Q |
237 |
gtttgtttgatggcagtacaaacctactcttttagggcttttatttgttgtatctttggatatcatttagatatt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32872565 |
gtttgtttgatggcagtacaaacctactcttttagggcttttatttgttgtatctttgtatatcatttagatatt |
32872639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University