View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19587_low_31 (Length: 218)
Name: NF19587_low_31
Description: NF19587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19587_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 41 - 199
Target Start/End: Original strand, 37655815 - 37655976
Alignment:
| Q |
41 |
atgactaaattttaaataaattaaaacgcaaagacaagagcacatacaaacatgtgaaacacacgtg-aaaattagatt-caagattagaagttccctta |
138 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
37655815 |
atgactaaattttaaataaattaaaacccaaagacaagagcacatacaaacatgtgaaacacacgtgaaaaattagattaaaagattagaagttccctta |
37655914 |
T |
|
| Q |
139 |
ttatatagcttgctactgccac-cacaactgtatgttttgggttcactgctagtgttcgacc |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37655915 |
ttatatagcttgctactgccacaaacaactgtatgttttgggttcactgctagtgttcgacc |
37655976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University