View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19588_high_2 (Length: 238)
Name: NF19588_high_2
Description: NF19588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19588_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 36898928 - 36898698
Alignment:
| Q |
1 |
tatgataatactagtattatgatagtggttcaagttaaactccaccagttctaaattgtcgatagtacatttgactttaaatttggtttcatggcaccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36898928 |
tatgataatactagtattatgatagtggttcaagttaaactccaccagttctaaattgtcgatagtacatttgactttaaatttggtttcatggcaccag |
36898829 |
T |
 |
| Q |
101 |
cttcgcacgtatgcctgagtgctaacccatttcctaagatggaactcaattaacagtatatgtcaacctcccatggcataatttttctttgaaatgtcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36898828 |
cttcgcacgtatgcctgagtgctaacccatttcctaagatggaactcaactaacagcatatgtcaacctcccatggcataatttttctttgaaatgtcct |
36898729 |
T |
 |
| Q |
201 |
acaagaaagtacattaatagatgatgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |
|
|
| T |
36898728 |
acaagaaagtacattaatagatggtgatgtc |
36898698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 228
Target Start/End: Original strand, 37009963 - 37010020
Alignment:
| Q |
171 |
ccatggcataatttttctttgaaatgtcctacaagaaagtacattaatagatgatgat |
228 |
Q |
| |
|
||||| ||||| ||| ||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37009963 |
ccatgacataaatttccttagaaatgtcctacaagaaggtacattaattaatgatgat |
37010020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University