View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_high_42 (Length: 305)
Name: NF19589_high_42
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_high_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 22 - 163
Target Start/End: Complemental strand, 24757529 - 24757388
Alignment:
| Q |
22 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctagttaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24757529 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctagttaa |
24757430 |
T |
|
| Q |
122 |
acctagatatttcgttttgtgttgcctttataagttctaatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24757429 |
acctagatatttcgttttgtgttgcctttataagttctaatt |
24757388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 22 - 163
Target Start/End: Complemental strand, 24766526 - 24766385
Alignment:
| Q |
22 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctagttaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24766526 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctagttaa |
24766427 |
T |
|
| Q |
122 |
acctagatatttcgttttgtgttgcctttataagttctaatt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24766426 |
acctagatatttcgttttgtgttgcctttataagttctaatt |
24766385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 219 - 296
Target Start/End: Complemental strand, 24757342 - 24757265
Alignment:
| Q |
219 |
acaaaacttatatttcgtctgcttttgttgttggtaacttagtatatccgatttttgctgattcacattttagaatta |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24757342 |
acaaaacttatatttcgtctgcttttgttgttggtaacttagtatatccgatttttgctgattcacattttataatta |
24757265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 219 - 296
Target Start/End: Complemental strand, 24766339 - 24766262
Alignment:
| Q |
219 |
acaaaacttatatttcgtctgcttttgttgttggtaacttagtatatccgatttttgctgattcacattttagaatta |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24766339 |
acaaaacttatatttcgtctgcttttgttgttggtaacttagtatatccgatttttgctgattcacattttataatta |
24766262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 24995890 - 24995955
Alignment:
| Q |
22 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| | | |||||||||||||||| |
|
|
| T |
24995890 |
cttgggctctttggtgatggatttgatgtcgtttttgaaattgccctgcgaaactataacctaggc |
24995955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 23682845 - 23682908
Alignment:
| Q |
22 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag |
85 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| ||||| || |||||| ||||||| |
|
|
| T |
23682845 |
cttgggctcattggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag |
23682908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 24055082 - 24055145
Alignment:
| Q |
22 |
cttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag |
85 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| ||||| || |||||| ||||||| |
|
|
| T |
24055082 |
cttgggctcattggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag |
24055145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University