View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_high_66 (Length: 231)
Name: NF19589_high_66
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_high_66 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 16107289 - 16107499
Alignment:
| Q |
21 |
gttgcggcggttaaagagattgtgaattgtacggaacaagagatctatgatgttcttagggagtgtgatatggaccctaatctcgctgttgagaagcttc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16107289 |
gttgcggcggttaaagagattgtgaattgtacggaacaagagatctatgatgttcttagggagtgtgatatggaccctaatctcgctgttgagaagcttc |
16107388 |
T |
|
| Q |
121 |
tctctcaaggtttttcgattcttgagaatttttcgccatcgnnnnnnnnngttcggttacgtttctaacgtttcgattttgttgcatggaagaaaattag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16107389 |
tctctcaaggtttttcgattcttgagaatttttcgctatcgtttttttttgttcggttacgtttctaacgttttgattttgttgcatggaagaaaattag |
16107488 |
T |
|
| Q |
221 |
tgaagatgatg |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
16107489 |
tgaagatgatg |
16107499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University