View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_high_69 (Length: 225)
Name: NF19589_high_69
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_high_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 32960272 - 32960081
Alignment:
| Q |
16 |
aatattccaaatgttaaatttcttcccattgtgttgtggtcctggtcgtatggagctagagtgataatgttcctaattggaaaagtcaaacttttatatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32960272 |
aatattccaaatgttaaatttcttcccaatgtgttgtggtcctggtcgtatggagctagagtgataatgttcctaattggaaaagtcaaacttttatatc |
32960173 |
T |
|
| Q |
116 |
ttttttctgaaattggcatgtacctaatgcacctggctttttcttttgtgatagaaagcaaagccaaaagaagtaatattgcaggttggagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32960172 |
ttttttctgaaattggcatgtacctaatgcacctggctttttcttttgtgatagaaagcaaagccaaaagaagtaatattgcaggttggagc |
32960081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University