View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_high_70 (Length: 222)
Name: NF19589_high_70
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_high_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 50 - 205
Target Start/End: Original strand, 45653213 - 45653368
Alignment:
| Q |
50 |
ttatatttcaaatcagcagaaatatgcagccaggaaagcaacaaaaattaccggaaattgttgatgcccagacaaagccagttcgtgcttattatcaata |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45653213 |
ttatatttcaaatcagcagaaatatgcagccaggaaagcaacaaaaattaccggaaattgttgatgcccagacaaagccagttcgtgcttattatcaata |
45653312 |
T |
|
| Q |
150 |
gcttccacaaacaactcaaactcggtgaatagaggctgataatctaagagaattgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45653313 |
gcttccacaaacaactcaaactcggtgaatagaggctgataatctaagagaattgg |
45653368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University