View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_low_43 (Length: 324)
Name: NF19589_low_43
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 65 - 307
Target Start/End: Complemental strand, 18094745 - 18094515
Alignment:
| Q |
65 |
tttttctaaagggacatatgatagagctattattattcaatacaaacaaaacttaattgtcaaatttctaaggctacaagtcaatatgattgtccacttg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||| | | |||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
18094745 |
tttttctaaagggacatatgatagagctatcagt---caatacgaacaaaacttaattgtcaaatttctaaggctacaagtcaatatg-ttgcccacttg |
18094650 |
T |
|
| Q |
165 |
ctagcaaagagccaaagacatccataatcttttgttttgtagttgtcgtcatatattccattgtattcttttatagttgtcctatattgtcttaacatca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18094649 |
ctagcaaagagccaaagacatccataatc-----ttttgtagtt---gtcatatattccattgtattcttttatagttgtcctatattgtcttaacatca |
18094558 |
T |
|
| Q |
265 |
tctaggacacttgcaacactaagacaaaatggttacaacaagg |
307 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
18094557 |
cctaggacacttacaacactaagacaaaaaggttacaacaagg |
18094515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University