View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_low_45 (Length: 320)
Name: NF19589_low_45
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 34015311 - 34015046
Alignment:
| Q |
18 |
atacttgggtatatctctcaaaaagaatnnnnnnnntacttgtgtagtcttgcggaaacgaaagctaattggttgaacctttgattatg--gttcatgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34015311 |
atacttgggtatatctctcaaaaagaataaaaaaa-tacttgtgtagtcttgcggaaacgaaagctaattggttgaacctttgattatgtggttcatgaa |
34015213 |
T |
|
| Q |
116 |
tcaatctctaatctcaactttgtcgtttgtaaggaggtaatttttctgtctttatcttttctgtttattacgtgactgaaaaaacataagccaataatag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34015212 |
tcaatctctaatctcaactttgtcgtttgtaaggaggtaattattctgtgtttatcttttctgtttattacgtgactgaaaaaacataagccaataatag |
34015113 |
T |
|
| Q |
216 |
tgacgaaccccctcttacagctcccaaacaataatcatagagagtagaaacattcccattcttgaattcatttg |
289 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34015112 |
tgacgaaccccctcttacggctcccaaacaataatcatagag-------acattcccattcttgaattcatttg |
34015046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University