View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19589_low_54 (Length: 257)

Name: NF19589_low_54
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19589_low_54
NF19589_low_54
[»] chr6 (25 HSPs)
chr6 (79-202)||(3403923-3404045)
chr6 (108-202)||(2762509-2762603)
chr6 (109-202)||(18242090-18242183)
chr6 (80-185)||(21031978-21032081)
chr6 (77-195)||(30388305-30388420)
chr6 (89-139)||(2762614-2762664)
chr6 (89-139)||(10039840-10039890)
chr6 (89-134)||(3403867-3403912)
chr6 (89-134)||(30388242-30388287)
chr6 (76-196)||(13579592-13579709)
chr6 (81-136)||(3403717-3403771)
chr6 (80-139)||(18241853-18241911)
chr6 (89-135)||(18242033-18242079)
chr6 (79-189)||(33829584-33829692)
chr6 (79-136)||(10039674-10039729)
chr6 (76-189)||(33828985-33829096)
chr6 (81-172)||(11656746-11656836)
chr6 (89-135)||(33972190-33972236)
chr6 (89-138)||(11656611-11656660)
chr6 (79-131)||(21032285-21032336)
chr6 (84-139)||(3825530-3825583)
chr6 (84-135)||(33658566-33658617)
chr6 (89-139)||(21032108-21032158)
chr6 (80-137)||(33655114-33655169)
chr6 (89-137)||(13579527-13579575)
[»] scaffold0192 (2 HSPs)
scaffold0192 (80-202)||(25303-25424)
scaffold0192 (89-134)||(25247-25292)
[»] chr2 (40 HSPs)
chr2 (80-202)||(11883622-11883743)
chr2 (79-195)||(30190921-30191036)
chr2 (84-202)||(40469663-40469780)
chr2 (80-202)||(20347398-20347519)
chr2 (71-183)||(24832321-24832432)
chr2 (80-202)||(6171391-6171511)
chr2 (81-139)||(11883923-11883980)
chr2 (89-135)||(32673020-32673066)
chr2 (84-202)||(32673077-32673193)
chr2 (89-134)||(11883754-11883799)
chr2 (89-134)||(40469607-40469652)
chr2 (77-189)||(26841583-26841693)
chr2 (75-202)||(26737715-26737841)
chr2 (79-189)||(2639430-2639538)
chr2 (89-135)||(6171334-6171380)
chr2 (89-135)||(20347341-20347387)
chr2 (89-135)||(26737657-26737703)
chr2 (89-135)||(30191054-30191100)
chr2 (81-189)||(26842186-26842292)
chr2 (75-139)||(30191222-30191285)
chr2 (93-136)||(40221488-40221531)
chr2 (84-139)||(43495481-43495535)
chr2 (80-189)||(2638819-2638926)
chr2 (75-136)||(5378655-5378715)
chr2 (70-139)||(40469416-40469484)
chr2 (80-136)||(18296693-18296748)
chr2 (80-139)||(26737481-26737537)
chr2 (76-136)||(41790912-41790971)
chr2 (89-135)||(15920912-15920958)
chr2 (89-139)||(17345862-17345912)
chr2 (70-136)||(17850967-17851032)
chr2 (109-139)||(18055073-18055103)
chr2 (81-134)||(6171156-6171207)
chr2 (92-189)||(7591212-7591307)
chr2 (78-139)||(17346032-17346091)
chr2 (79-136)||(20347161-20347217)
chr2 (70-135)||(32672832-32672895)
chr2 (149-189)||(7591798-7591837)
chr2 (91-139)||(15920788-15920835)
chr2 (80-136)||(37720203-37720258)
[»] chr1 (34 HSPs)
chr1 (1-80)||(29391807-29391890)
chr1 (75-195)||(47955300-47955419)
chr1 (83-202)||(17518538-17518653)
chr1 (81-202)||(41082909-41083028)
chr1 (84-202)||(22149636-22149750)
chr1 (89-135)||(17518481-17518527)
chr1 (84-134)||(22149580-22149630)
chr1 (151-202)||(8108956-8109007)
chr1 (80-139)||(13589656-13589713)
chr1 (89-135)||(47955437-47955483)
chr1 (80-189)||(49284408-49284515)
chr1 (80-136)||(8108993-8109048)
chr1 (79-139)||(47955605-47955664)
chr1 (76-139)||(17518298-17518359)
chr1 (92-135)||(41083042-41083085)
chr1 (83-189)||(6002842-6002946)
chr1 (89-135)||(8108899-8108945)
chr1 (75-136)||(19008750-19008810)
chr1 (75-136)||(48190765-48190825)
chr1 (80-139)||(22149402-22149458)
chr1 (79-139)||(31848189-31848248)
chr1 (79-139)||(41083208-41083266)
chr1 (70-189)||(6002226-6002343)
chr1 (79-138)||(8108719-8108777)
chr1 (77-136)||(44911021-44911079)
chr1 (81-136)||(48105116-48105170)
chr1 (79-136)||(28633718-28633774)
chr1 (84-185)||(31847898-31847997)
chr1 (79-136)||(32163043-32163099)
chr1 (79-136)||(48191355-48191411)
chr1 (75-136)||(48313792-48313852)
chr1 (76-136)||(9347121-9347180)
chr1 (84-132)||(31848019-31848067)
chr1 (80-136)||(39692000-39692055)
[»] scaffold0319 (3 HSPs)
scaffold0319 (81-202)||(6631-6750)
scaffold0319 (80-139)||(6393-6451)
scaffold0319 (89-134)||(6575-6620)
[»] chr8 (48 HSPs)
chr8 (81-202)||(41662337-41662457)
chr8 (81-202)||(43245871-43245991)
chr8 (83-202)||(765736-765854)
chr8 (80-202)||(12281123-12281244)
chr8 (81-202)||(15156119-15156239)
chr8 (77-202)||(16928938-16929060)
chr8 (109-195)||(74926-75011)
chr8 (149-202)||(37752181-37752234)
chr8 (75-139)||(12281423-12281486)
chr8 (89-135)||(15156062-15156108)
chr8 (78-139)||(15155880-15155940)
chr8 (89-134)||(37752245-37752290)
chr8 (154-202)||(43162471-43162519)
chr8 (91-134)||(43246004-43246047)
chr8 (80-139)||(43246173-43246231)
chr8 (89-135)||(12281255-12281301)
chr8 (81-139)||(16929239-16929296)
chr8 (89-139)||(18019918-18019968)
chr8 (81-139)||(37752413-37752470)
chr8 (75-189)||(39723996-39724108)
chr8 (80-189)||(9823309-9823416)
chr8 (89-134)||(41662281-41662326)
chr8 (81-185)||(3463896-3463999)
chr8 (89-137)||(9465703-9465751)
chr8 (77-189)||(13026631-13026741)
chr8 (81-136)||(37752084-37752138)
chr8 (89-132)||(43162417-43162460)
chr8 (89-135)||(765865-765911)
chr8 (84-134)||(16929065-16929115)
chr8 (70-139)||(34313754-34313820)
chr8 (89-135)||(34313941-34313987)
chr8 (153-195)||(34314005-34314047)
chr8 (84-189)||(13027229-13027332)
chr8 (83-139)||(23123514-23123567)
chr8 (149-202)||(37670189-37670241)
chr8 (75-135)||(15042139-15042198)
chr8 (89-136)||(7127827-7127874)
chr8 (108-139)||(33748157-33748188)
chr8 (77-136)||(34498555-34498613)
chr8 (80-139)||(41662106-41662164)
chr8 (75-189)||(9822742-9822854)
chr8 (80-189)||(13936722-13936827)
chr8 (75-189)||(22851384-22851496)
chr8 (89-138)||(7127661-7127708)
chr8 (79-136)||(13937389-13937445)
chr8 (167-195)||(18019872-18019900)
chr8 (80-139)||(18020085-18020141)
chr8 (149-189)||(39723469-39723508)
[»] chr7 (37 HSPs)
chr7 (77-202)||(9412259-9412383)
chr7 (81-202)||(3687591-3687710)
chr7 (80-139)||(9412022-9412080)
chr7 (151-202)||(5349696-5349747)
chr7 (91-134)||(13772793-13772836)
chr7 (76-139)||(13772898-13772960)
chr7 (89-135)||(9412202-9412248)
chr7 (71-189)||(44599479-44599595)
chr7 (72-189)||(13863304-13863419)
chr7 (80-189)||(44600083-44600190)
chr7 (109-196)||(29291983-29292068)
chr7 (151-195)||(35080193-35080237)
chr7 (151-202)||(6908448-6908498)
chr7 (74-185)||(23686414-23686522)
chr7 (75-130)||(23686723-23686777)
chr7 (93-135)||(6908391-6908433)
chr7 (78-136)||(13772638-13772695)
chr7 (71-136)||(10533024-10533088)
chr7 (109-202)||(34235913-34236005)
chr7 (76-139)||(3687348-3687411)
chr7 (75-135)||(6908207-6908265)
chr7 (77-189)||(8643714-8643824)
chr7 (92-136)||(18925229-18925273)
chr7 (84-139)||(27096168-27096223)
chr7 (84-139)||(27182080-27182135)
chr7 (89-135)||(3687534-3687580)
chr7 (89-135)||(5735383-5735429)
chr7 (70-136)||(20418877-20418942)
chr7 (74-136)||(37972396-37972457)
chr7 (89-139)||(38191391-38191440)
chr7 (82-139)||(8953886-8953941)
chr7 (76-137)||(9034862-9034922)
chr7 (80-189)||(13863905-13864011)
chr7 (107-136)||(15567017-15567046)
chr7 (79-136)||(37889259-37889315)
chr7 (95-135)||(6908485-6908524)
chr7 (76-136)||(37888828-37888887)
[»] chr5 (32 HSPs)
chr5 (81-202)||(18433015-18433135)
chr5 (71-202)||(26020440-26020570)
chr5 (79-202)||(25115755-25115877)
chr5 (79-202)||(25174847-25174969)
chr5 (151-202)||(22429159-22429210)
chr5 (76-139)||(25175148-25175210)
chr5 (95-202)||(34576880-34576985)
chr5 (70-132)||(16466746-16466807)
chr5 (89-134)||(18433146-18433191)
chr5 (76-137)||(25116060-25116120)
chr5 (84-133)||(34576991-34577040)
chr5 (75-138)||(5187828-5187890)
chr5 (80-139)||(18433313-18433371)
chr5 (89-135)||(25115888-25115934)
chr5 (89-135)||(25174980-25175026)
chr5 (151-195)||(5187591-5187635)
chr5 (81-189)||(18817559-18817665)
chr5 (69-136)||(12498555-12498621)
chr5 (77-136)||(22428930-22428987)
chr5 (78-136)||(22429196-22429252)
chr5 (154-195)||(9665598-9665639)
chr5 (76-189)||(18816947-18817058)
chr5 (75-135)||(23011073-23011131)
chr5 (89-133)||(26020581-26020625)
chr5 (80-136)||(41383167-41383221)
chr5 (84-139)||(9869735-9869790)
chr5 (89-139)||(5187653-5187703)
chr5 (78-136)||(12498928-12498985)
chr5 (78-136)||(26571164-26571221)
chr5 (94-139)||(9665662-9665707)
chr5 (104-132)||(5779742-5779770)
chr5 (70-134)||(37780744-37780806)
[»] chr4 (39 HSPs)
chr4 (81-202)||(16555751-16555871)
chr4 (79-202)||(3930414-3930535)
chr4 (84-195)||(13198606-13198717)
chr4 (78-139)||(16555512-16555572)
chr4 (89-134)||(16555695-16555740)
chr4 (89-139)||(27304890-27304940)
chr4 (80-137)||(8182171-8182228)
chr4 (153-202)||(11241624-11241673)
chr4 (91-135)||(11241567-11241611)
chr4 (151-202)||(5206193-5206244)
chr4 (81-135)||(5206231-5206283)
chr4 (80-139)||(13198903-13198961)
chr4 (80-139)||(18077199-18077257)
chr4 (89-135)||(3930357-3930403)
chr4 (79-189)||(50678777-50678885)
chr4 (82-139)||(8181992-8182049)
chr4 (79-136)||(56505691-56505747)
chr4 (89-133)||(22681710-22681754)
chr4 (154-202)||(35393548-35393596)
chr4 (89-136)||(49178647-49178694)
chr4 (89-139)||(5206132-5206182)
chr4 (81-139)||(11241389-11241446)
chr4 (89-135)||(13198735-13198781)
chr4 (82-139)||(8488479-8488534)
chr4 (92-133)||(35393610-35393651)
chr4 (81-189)||(50679372-50679478)
chr4 (80-139)||(35393773-35393830)
chr4 (89-135)||(8488315-8488361)
chr4 (78-136)||(28196343-28196400)
chr4 (70-136)||(32703650-32703715)
chr4 (75-189)||(36096423-36096535)
chr4 (74-136)||(39744465-39744526)
chr4 (89-139)||(49178813-49178862)
chr4 (75-136)||(9023238-9023298)
chr4 (153-202)||(22681651-22681699)
chr4 (80-136)||(24775783-24775838)
chr4 (80-136)||(28196773-28196828)
chr4 (80-136)||(36095816-36095871)
chr4 (80-132)||(39415528-39415579)
[»] scaffold0110 (3 HSPs)
scaffold0110 (72-195)||(45748-45869)
scaffold0110 (89-135)||(45684-45730)
scaffold0110 (80-139)||(45536-45593)
[»] scaffold0802 (3 HSPs)
scaffold0802 (81-202)||(1354-1474)
scaffold0802 (89-135)||(1297-1343)
scaffold0802 (81-139)||(1118-1175)
[»] chr3 (27 HSPs)
chr3 (81-202)||(20968954-20969073)
chr3 (116-196)||(10293642-10293722)
chr3 (150-202)||(18874957-18875009)
chr3 (75-139)||(10293906-10293969)
chr3 (89-135)||(10293738-10293784)
chr3 (89-135)||(20968897-20968943)
chr3 (89-134)||(18875020-18875065)
chr3 (75-172)||(18875155-18875251)
chr3 (80-137)||(47871121-47871176)
chr3 (89-133)||(9026863-9026907)
chr3 (81-136)||(3644783-3644837)
chr3 (80-139)||(20968717-20968775)
chr3 (74-135)||(1101182-1101242)
chr3 (81-138)||(17372298-17372354)
chr3 (90-139)||(17372470-17372519)
chr3 (84-136)||(13657621-13657673)
chr3 (84-139)||(14015867-14015923)
chr3 (79-135)||(18874880-18874935)
chr3 (79-135)||(45060872-45060927)
chr3 (84-139)||(1101087-1101141)
chr3 (149-192)||(9026800-9026842)
chr3 (89-139)||(4947389-4947439)
chr3 (79-136)||(48159895-48159951)
chr3 (75-135)||(1927766-1927825)
chr3 (84-136)||(3644720-3644772)
chr3 (81-137)||(13657445-13657500)
chr3 (76-136)||(14015964-14016022)
[»] scaffold0002 (2 HSPs)
scaffold0002 (81-202)||(411923-412041)
scaffold0002 (89-127)||(412052-412090)
[»] scaffold0001 (5 HSPs)
scaffold0001 (81-139)||(438930-438987)
scaffold0001 (79-139)||(439196-439255)
scaffold0001 (89-132)||(439029-439072)
scaffold0001 (80-139)||(183660-183717)
scaffold0001 (84-132)||(183544-183592)
[»] scaffold1221 (2 HSPs)
scaffold1221 (153-202)||(1552-1601)
scaffold1221 (89-135)||(1612-1658)
[»] scaffold0015 (2 HSPs)
scaffold0015 (149-194)||(16920-16965)
scaffold0015 (81-139)||(17153-17209)
[»] scaffold0328 (2 HSPs)
scaffold0328 (81-189)||(6152-6258)
scaffold0328 (81-189)||(6743-6849)
[»] scaffold0598 (1 HSPs)
scaffold0598 (152-202)||(6809-6860)
[»] scaffold0009 (1 HSPs)
scaffold0009 (80-139)||(205686-205743)
[»] scaffold0376 (2 HSPs)
scaffold0376 (81-139)||(7597-7653)
scaffold0376 (80-136)||(7454-7508)
[»] scaffold0035 (1 HSPs)
scaffold0035 (82-139)||(72967-73023)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 25)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 79 - 202
Target Start/End: Complemental strand, 3404045 - 3403923
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||    
3404045 taggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgcccc 3403947  T
179 ctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||| |||||    
3403946 ctttctgattttgcaccccatctt 3403923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 108 - 202
Target Start/End: Original strand, 2762509 - 2762603
Alignment:
108 tttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||||||||||||||||||||||         ||| |||||||||||||||||||||||||||||| ||||||||||||| |||||    
2762509 tttttgctaattgtgcgattttgcaccccctctttttttttgagtgattttgcacctcatctttttgccccctttttgattttgcaccccatctt 2762603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 109 - 202
Target Start/End: Complemental strand, 18242183 - 18242090
Alignment:
109 ttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    |||||| ||||||||||||||||||||||||         ||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
18242183 ttttgccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccctttctgattttgcaccccatctt 18242090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 185
Target Start/End: Original strand, 21031978 - 21032081
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| ||||||||||||||| |   |||||||||||||||||||||||||||||||         ||||||||||||||| |||||||||||||||    
21031978 aggcttaattgcacttttccccctaac--ttttgctaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccc 21032075  T
180 tttctg 185  Q
    ||||||    
21032076 tttctg 21032081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 77 - 195
Target Start/End: Complemental strand, 30388420 - 30388305
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    |||||| |||| || |||||| |||| |||||||| ||||||||||||||||||||||||||          ||||||||||||||| ||||||||| ||    
30388420 tttaggtttaattgtactttttccccctatctttt-gctaattgtgcgattttgcacccccttttttttt--gagcgattttgcaccccatctttttacc 30388324  T
177 ccctttctgattttgcacc 195  Q
    |||||||||||||||||||    
30388323 ccctttctgattttgcacc 30388305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 2762614 - 2762664
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||    
2762614 tgcacttttgccccctatctttttgctaattgtgcgattttgcaccccctc 2762664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Complemental strand, 10039890 - 10039840
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||    
10039890 tgcacttttgccccctatctttttgctaattgtgcgattttgcaccccctc 10039840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 3403912 - 3403867
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
3403912 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 3403867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 30388287 - 30388242
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
30388287 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 30388242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 196
Target Start/End: Complemental strand, 13579709 - 13579592
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgc 175  Q
    |||||||||||| |||||||||| |||| ||| ||| |||||||||||||||||||||||||||          |||||||||||||| ||| ||||||     
13579709 ttttaggcttaattgcacttttctccct-atcgttt-gctaattgtgcgattttgcaccccctcgttttttt-tagcgattttgcaccccatttttttgg 13579613  T
176 cccctttctgattttgcaccc 196  Q
    ||||||||| |||||||||||    
13579612 cccctttcttattttgcaccc 13579592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 81 - 136
Target Start/End: Original strand, 3403717 - 3403771
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||    
3403717 ggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcacccc 3403771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 18241853 - 18241911
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
18241853 aggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 18241911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 18242079 - 18242033
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||    
18242079 tgcacttttgccccttatctttttgttaattgtgcgattttgcaccc 18242033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 189
Target Start/End: Complemental strand, 33829692 - 33829584
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||    
33829692 taggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-cccc 33829595  T
179 ctttctgattt 189  Q
    |||||||||||    
33829594 ctttctgattt 33829584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 10039674 - 10039729
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||    
10039674 taggcttaattgcacttttccccct-atctttt-gctaattgtgcgattttgcacccc 10039729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 76 - 189
Target Start/End: Original strand, 33828985 - 33829096
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgc 175  Q
    |||| ||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |    
33828985 tttttggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-c 33829082  T
176 cccctttctgattt 189  Q
    ||||||||||||||    
33829083 cccctttctgattt 33829096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 172
Target Start/End: Complemental strand, 11656836 - 11656746
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttt 172  Q
    ||||||| |||||||||| | | |||||||| |||||||||||||||||||||||||||         ||||||||||||||| ||||||||    
11656836 ggcttaattgcacttttctctcctatctttt-gctaattgtgcgattttgcaccccctctttatttttgagcgattttgcaccccatctttt 11656746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 33972236 - 33972190
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||| ||||||||||||||||||| ||||||||||||    
33972236 tgcacttttgccccatatctttttgctaattgtgagattttgcaccc 33972190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 138
Target Start/End: Original strand, 11656611 - 11656660
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccct 138  Q
    ||||||||| |||| |||| ||||| ||||||||||||||||||||||||    
11656611 tgcacttttgccccctatcgttttgataattgtgcgattttgcaccccct 11656660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 131
Target Start/End: Complemental strand, 21032336 - 21032285
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgc 131  Q
    ||||||||| |||||||||||||| |||| ||||| |||||||||||||||||    
21032336 taggcttaattgcacttttcccccctatc-ttttgttaattgtgcgattttgc 21032285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 139
Target Start/End: Original strand, 3825530 - 3825583
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||||||||| || |||| |||||||||||||||||||||||||||    
3825530 ttaattgcacttttccccct-atatttt-gctaattgtgcgattttgcaccccctc 3825583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 135
Target Start/End: Original strand, 33658566 - 33658617
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||| ||||||||| ||| |||||||||||| |||||||| |||||||||||    
33658566 ttaattgcacttttgccctttatctttttgccaattgtgcaattttgcaccc 33658617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 21032108 - 21032158
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| |||||| |||  ||||||||||||||||||||||||    
21032108 tgcacttttgccccctatcttcttgtcaattgtgcgattttgcaccccctc 21032158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 137
Target Start/End: Complemental strand, 33655169 - 33655114
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    |||||||| ||||||| ||||| ||||||||| ||||||||||| |||||||||||||    
33655169 aggcttaattgcacttgtcccc-ttatctttt-gctaattgtgcaattttgcaccccc 33655114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 137
Target Start/End: Complemental strand, 13579575 - 13579527
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    ||||||||| |||| ||| |||||||||||||||| ||| |||||||||    
13579575 tgcacttttgccccctatatttttgctaattgtgcaattctgcaccccc 13579527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0192 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0192
Description:

Target: scaffold0192; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 80 - 202
Target Start/End: Complemental strand, 25424 - 25303
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||     
25424 aggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgcccca 25326  T
180 tttctgattttgcaccctatctt 202  Q
    ||||||||||||||||| |||||    
25325 tttctgattttgcaccccatctt 25303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0192; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 25292 - 25247
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
25292 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 25247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 40)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 80 - 202
Target Start/End: Original strand, 11883622 - 11883743
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||         |||| ||||||||||||||||||||||||||    
11883622 aggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctctttttttttgagcaattttgcacctcatctttttgccccc 11883720  T
180 tttctgattttgcaccctatctt 202  Q
    ||| ||||||||||||| |||||    
11883721 tttatgattttgcaccccatctt 11883743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 79 - 195
Target Start/End: Original strand, 30190921 - 30191036
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||    
30190921 taggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgcccc 30191019  T
179 ctttctgattttgcacc 195  Q
    |||||||||||||||||    
30191020 ctttctgattttgcacc 30191036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 84 - 202
Target Start/End: Complemental strand, 40469780 - 40469663
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttc 183  Q
    |||| ||||||||| |||| |||||||| |||||||||||||||||||||||||||         ||||||||||||||| |||||||||||||||||||    
40469780 ttaattgcactttttccccctatctttt-gctaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccctttc 40469682  T
184 tgattttgcaccctatctt 202  Q
    ||||||||||||| |||||    
40469681 tgattttgcaccccatctt 40469663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 80 - 202
Target Start/End: Complemental strand, 20347519 - 20347398
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||| ||||||||||| |||||||||| ||||    
20347519 aggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagggattttgcaccccatctttttgtcccc 20347421  T
180 tttctgattttgcaccctatctt 202  Q
    ||||||||||||||||| |||||    
20347420 tttctgattttgcaccccatctt 20347398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 71 - 183
Target Start/End: Original strand, 24832321 - 24832432
Alignment:
71 tttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctt 170  Q
    |||||||| |||||||| |||||||||||||| |||| |||||||||||||||||||||||||||| ||         ||||||||||||||| ||||||    
24832321 tttattttaaggcttaattgcacttttcccccctatc-ttttgctaattgtgcgattttgcaccccatctttttttttgagcgattttgcaccccatctt 24832419  T
171 tttgccccctttc 183  Q
    |||||||||||||    
24832420 tttgccccctttc 24832432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 202
Target Start/End: Complemental strand, 6171511 - 6171391
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||||||| |||||||| || ||||||| ||||||||||||| ||         |||| |||||||||| |||||||||||||||    
6171511 aggcttaattgcacttttcccccctatctttt-gccaattgtgggattttgcacccc-tctttttttttgagcaattttgcaccccatctttttgccccc 6171414  T
180 tttctgattttgcaccctatctt 202  Q
    ||||||||||||||||| |||||    
6171413 tttctgattttgcaccccatctt 6171391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 11883980 - 11883923
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||    
11883980 ggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctc 11883923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 32673066 - 32673020
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
32673066 tgcacttttgccccttatctttttgctaattgtgcgattttgcaccc 32673020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 84 - 202
Target Start/End: Complemental strand, 32673193 - 32673077
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttc 183  Q
    |||| ||||||||| ||||| ||||||| || |||||||||||||||||||||||          ||||||||||||||| |||||||| |||| |||||    
32673193 ttaattgcactttttcccct-atctttt-gccaattgtgcgattttgcaccccctatttttttttgagcgattttgcaccccatcttttcgccctctttc 32673096  T
184 tgattttgcaccctatctt 202  Q
    ||||||||||||| |||||    
32673095 tgattttgcaccccatctt 32673077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 11883754 - 11883799
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
11883754 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 11883799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 40469652 - 40469607
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||    
40469652 tgcacttttcccccttatcgttttgctaattgtgcgattttgcacc 40469607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 77 - 189
Target Start/End: Original strand, 26841583 - 26841693
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    ||||||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||    
26841583 tttaggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-cc 26841680  T
177 ccctttctgattt 189  Q
    |||||||||||||    
26841681 ccctttctgattt 26841693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 26737841 - 26737715
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    ||||| ||||||| |||||||||| ||| |||||||| ||||| ||||||||||||||||||            ||| |||||| |||| |||| |||||    
26737841 ttttttggcttaattgcacttttcacccctatctttt-gctaactgtgcgattttgcacccctcttttttttttgagagattttacaccccatccttttg 26737743  T
175 ccccctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||||||| |||||    
26737742 ccccctttctgattttgcaccccatctt 26737715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 189
Target Start/End: Complemental strand, 2639538 - 2639430
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||    
2639538 taggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-cccc 2639441  T
179 ctttctgattt 189  Q
    |||||||||||    
2639440 ctttctgattt 2639430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 6171380 - 6171334
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||    
6171380 tgcacttttgccccttatctttttgttaattgtgcgattttgcaccc 6171334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 20347387 - 20347341
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||    
20347387 tgcacttttgtcccttatctttttgctaattgtgcgattttgcaccc 20347341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 26737703 - 26737657
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||    
26737703 tgcacttttgccccctatctttttgctaattgtgcgattttgcaccc 26737657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 30191054 - 30191100
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||    
30191054 tgcacttttgtcccttatctttttgctaattgtgcgattttgcaccc 30191100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 81 - 189
Target Start/End: Complemental strand, 26842292 - 26842186
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||||    
26842292 ggcttaagtgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccct 26842195  T
181 ttctgattt 189  Q
    |||||||||    
26842194 ttctgattt 26842186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 75 - 139
Target Start/End: Complemental strand, 30191285 - 30191222
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||| ||||||| |||||||||||||| ||||||||   |||||||||||||||||||||||||    
30191285 ttttttggcttaattgcacttttcccccctatcttttat-taattgtgcgattttgcaccccctc 30191222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 136
Target Start/End: Complemental strand, 40221531 - 40221488
Alignment:
93 cttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||| |||| |||||||||||||||||||||||||||||||||    
40221531 cttttgccccctatctttttgctaattgtgcgattttgcacccc 40221488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 43495535 - 43495481
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||||||||| |||||||||  ||||||||||||||||||||||||    
43495535 ttaattgcacttttccccct-atctttttgtcaattgtgcgattttgcaccccctc 43495481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 80 - 189
Target Start/End: Original strand, 2638819 - 2638926
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||| ||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||    
2638819 aggcttaattgcatttttcacccctatctttt-gccaattgtgcgattttgcaccccatatttttaaacgagcgattttgcaccccatcttttt-ccccc 2638916  T
180 tttctgattt 189  Q
    ||||||||||    
2638917 tttctgattt 2638926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 75 - 136
Target Start/End: Original strand, 5378655 - 5378715
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||||| |||||||||||||| |||   ||||| |||||||||||||||||||||    
5378655 tttttaggcttaattgcacttttcccccctat-agtttgccaattgtgcgattttgcacccc 5378715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 70 - 139
Target Start/End: Original strand, 40469416 - 40469484
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||| ||||||| || | ||||||| | |||||||| |||||||||||||||||||||||||||    
40469416 tttttttttttggcttaattgtatttttccctcctatctttt-gctaattgtgcgattttgcaccccctc 40469484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 18296748 - 18296693
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||| ||| |||||||| || |||||||||||||||||||||    
18296748 aggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcacccc 18296693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 26737481 - 26737537
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||| ||  |||||||| |||||||||||||||||||||||||||    
26737481 aggcttaattgcacttttctcc--tatctttt-gctaattgtgcgattttgcaccccctc 26737537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 136
Target Start/End: Complemental strand, 41790971 - 41790912
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||||| |||||||||||||| |||  |||||| |||||||||||||||| ||||    
41790971 ttttaggcttaattgcacttttcccccctat-attttgccaattgtgcgattttgcccccc 41790912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 15920958 - 15920912
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||| || ||||||||||||||||||||||| |||||    
15920958 tgcacttttgccccctaactttttgctaattgtgcgattttacaccc 15920912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 17345862 - 17345912
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| ||| |||||| ||||||||||||||| |||||||||    
17345862 tgcacttttgccccctatatttttgttaattgtgcgatttttcaccccctc 17345912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 136
Target Start/End: Original strand, 17850967 - 17851032
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| ||||| ||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
17850967 tttttttttttggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 17851032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 139
Target Start/End: Original strand, 18055073 - 18055103
Alignment:
109 ttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||||||||||||||||||||||||    
18055073 ttttgctaattgtgcgattttgcaccccctc 18055103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 81 - 134
Target Start/End: Original strand, 6171156 - 6171207
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||| ||||||||||||||| ||||||| | ||||||||||||||||||||    
6171156 ggcttaattgcacttttccccct-atctttt-gttaattgtgcgattttgcacc 6171207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 189
Target Start/End: Original strand, 7591212 - 7591307
Alignment:
92 acttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattt 189  Q
    ||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||||||||||||    
7591212 acttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccctttctgattt 7591307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 78 - 139
Target Start/End: Complemental strand, 17346091 - 17346032
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||| ||||||||| ||  ||||||||| |||||||||||||||||||||| ||||    
17346091 ttaggcttaattgcactttttcct-ttatctttt-gctaattgtgcgattttgcacctcctc 17346032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 20347161 - 20347217
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| | |||||||||||  |||||||| | ||||||||||||||||||||||    
20347161 taggcttaattacacttttcccctctatctttt-gttaattgtgcgattttgcacccc 20347217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 135
Target Start/End: Original strand, 32672832 - 32672895
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||| ||||||| |||||||||   ||||||||||| | |||||||||||||||||||||    
32672832 ttttattttt-ggcttaattgcacttttgttccttatctttt-gttaattgtgcgattttgcaccc 32672895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 189
Target Start/End: Complemental strand, 7591837 - 7591798
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattt 189  Q
    ||||||||||||||||||| ||||| |||||||||||||||    
7591837 gagcgattttgcacctcat-ttttttccccctttctgattt 7591798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Original strand, 15920788 - 15920835
Alignment:
91 cacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||| | |||||||| | |||||||||||||||||||||||||    
15920788 cacttttccctcctatctttt-gttaattgtgcgattttgcaccccctc 15920835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Original strand, 37720203 - 37720258
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
37720203 aggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 37720258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 34)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 29391807 - 29391890
Alignment:
1 gaatagcggtttctatgaataaactatgacttttggtttaaattttttgattc----tcgatggtaatcacccttttattttta 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||    
29391807 gaatagcggtttctatgaataaactatgacttttggtttaaattttttgattctcgatcgatggtaatcacccttttattttta 29391890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 75 - 195
Target Start/End: Original strand, 47955300 - 47955419
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    |||| |||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||    
47955300 ttttaaggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttg 47955398  T
175 ccccctttctgattttgcacc 195  Q
    |||||||||||||||||||||    
47955399 ccccctttctgattttgcacc 47955419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 83 - 202
Target Start/End: Complemental strand, 17518653 - 17518538
Alignment:
83 cttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccccttt 182  Q
    ||||| ||||||||||||||| ||||||| || ||||||||||||||||||||||||        | ||| |||||||||| ||||||||||||||||||    
17518653 cttaattgcacttttccccct-atctttt-gccaattgtgcgattttgcaccccctcttttttttg-agcaattttgcacc-catctttttgcccccttt 17518558  T
183 ctgattttgcaccctatctt 202  Q
    |||||||||||||| |||||    
17518557 ctgattttgcaccccatctt 17518538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 202
Target Start/End: Original strand, 41082909 - 41083028
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| || |||||| |||| |||||||| || ||||||||||||||||| ||||||          |||||||||||||| ||||||||||||||||    
41082909 ggcttaattgtactttttccccctatctttt-gccaattgtgcgattttgcatcccctcttttttttt-agcgattttgcaccccatctttttgccccct 41083006  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
41083007 ttctgattttgcaccccatctt 41083028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 202
Target Start/End: Complemental strand, 22149750 - 22149636
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttc 183  Q
    |||| |||||||||||||| |||||||| |||||||||||||||||||||| |||           |||||||||||||| |||||||||| ||||||||    
22149750 ttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcacctcctttttttttt--agcgattttgcaccccatctttttg-cccctttc 22149655  T
184 tgattttgcaccctatctt 202  Q
    ||||||||||||| |||||    
22149654 tgattttgcaccccatctt 22149636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 17518527 - 17518481
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
17518527 tgcacttttgccccttatctttttgctaattgtgcgattttgcaccc 17518481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 84 - 134
Target Start/End: Complemental strand, 22149630 - 22149580
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||||||||    
22149630 ttaattgcacttttgccccttatctttttgctaattgtgcgattttgcacc 22149580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 8109007 - 8108956
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||| |||||||||||||||||| ||||||||||||| |||||    
8109007 gcgattttgcaccccatctttttgccccctttttgattttgcaccccatctt 8108956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 13589713 - 13589656
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||    
13589713 aggcttaattgcacttttccccct-atctttt-gctaattgtgcgattttgcaccccctc 13589656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 47955437 - 47955483
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||    
47955437 tgcacttttgtcccttatctttttgctaattgtgcgattttgcaccc 47955483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 189
Target Start/End: Original strand, 49284408 - 49284515
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||    
49284408 aggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccc 49284505  T
180 tttctgattt 189  Q
    ||||||||||    
49284506 tttctgattt 49284515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 8109048 - 8108993
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||||||| |||||||| || |||||||||||||||||||||    
8109048 aggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcacccc 8108993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 47955664 - 47955605
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||||||||||||| ||||||||   |||||||||||||||||||||||||    
47955664 taggcttaattgcacttttcccccctatcttttat-taattgtgcgattttgcaccccctc 47955605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 139
Target Start/End: Original strand, 17518298 - 17518359
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||||| ||||| ||||||| ||||||||| | |||||||||||||||||||||||||    
17518298 ttttaggcttaattgcacctttcccc-ttatctttt-gttaattgtgcgattttgcaccccctc 17518359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 135
Target Start/End: Original strand, 41083042 - 41083085
Alignment:
92 acttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||| |||||||||||||| ||||||||||||||||||||||    
41083042 acttttgccccttatctttttactaattgtgcgattttgcaccc 41083085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 189
Target Start/End: Complemental strand, 6002946 - 6002842
Alignment:
83 cttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccccttt 182  Q
    ||||| ||||||||||  || |||||||| || ||||||||||||||||||||| |          ||||||||||||||||||||||||| ||||||||    
6002946 cttaattgcacttttcatccctatcttttcgc-aattgtgcgattttgcaccccatgtttttaaacgagcgattttgcacctcatcttttt-cccccttt 6002849  T
183 ctgattt 189  Q
    |||||||    
6002848 ctgattt 6002842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 8108945 - 8108899
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||| |||||||||||||||||||||||||| |||||    
8108945 tgcacttttgccccatatctttttgctaattgtgcgattttacaccc 8108899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 75 - 136
Target Start/End: Complemental strand, 19008810 - 19008750
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
19008810 tttttaggcttaattgcacttttcccccctatagtttcgc-aattgtgcgattttgcacccc 19008750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 75 - 136
Target Start/End: Original strand, 48190765 - 48190825
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||| ||||||| |||||||||| ||| |||||||| || |||||||||||||||||||||    
48190765 ttttttggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcacccc 48190825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 22149402 - 22149458
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||||||||||||| ||||||  | |||||||||||||||||||||||||    
22149402 aggcttaattgcacttttccccct-atcttt--ggtaattgtgcgattttgcaccccctc 22149458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 31848248 - 31848189
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||||||||| ||| |||||||| | ||||||| |||||||||||||||||    
31848248 taggcttaattgcacttttctcccctatctttt-gttaattgtacgattttgcaccccctc 31848189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 41083266 - 41083208
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| ||||||||||||||| ||||||| | || ||||||||||||||||||||||    
41083266 taggcttaattgcacttttccccct-atctttt-gttagttgtgcgattttgcaccccctc 41083208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 70 - 189
Target Start/End: Original strand, 6002226 - 6002343
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatct 169  Q
    |||| ||||| ||||||| |||||||||| ||| ||||||||  | ||||||| ||||||||||||| |          ||||||||||||||| |||||    
6002226 tttttttttttggcttaattgcacttttcacccctatcttttgtc-aattgtgtgattttgcaccccatgtttttaaacgagcgattttgcaccccatct 6002324  T
170 ttttgccccctttctgattt 189  Q
    |||| |||||||||||||||    
6002325 tttt-ccccctttctgattt 6002343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 138
Target Start/End: Original strand, 8108719 - 8108777
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccct 138  Q
    |||| |||| ||||||||||| || |||||||| | ||||||||||||||||||||||||    
8108719 taggtttaattgcacttttcctccctatctttt-gttaattgtgcgattttgcaccccct 8108777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 44911021 - 44911079
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||| |||||||| ||||| ||| |||| || |||||||||||||||||||||    
44911021 tttaggcttaattgcactttccccccctatatttt-gccaattgtgcgattttgcacccc 44911079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 81 - 136
Target Start/End: Complemental strand, 48105170 - 48105116
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| ||||||||||||||||||  ||| || |||||||||||||||||||||    
48105170 ggcttaattgcacttttcccccttatagttt-gccaattgtgcgattttgcacccc 48105116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 28633718 - 28633774
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| ||||||||||||||||||   ||||| |||||| ||||||||||||||    
28633718 taggcttaattgcacttttcccccttat-agtttgccaattgtacgattttgcacccc 28633774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 185
Target Start/End: Original strand, 31847898 - 31847997
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttc 183  Q
    |||| |||||||| |||||||||| ||||||||||||||| |||||||| ||| |          |||||||||||||||  ||||||||||||||||||    
31847898 ttaattgcactttacccccttatc-ttttgctaattgtgcaattttgcatcccat-attttttttgagcgattttgcacccgatctttttgccccctttc 31847995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 32163099 - 32163043
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
32163099 taggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 32163043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 48191411 - 48191355
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||| ||| |||||||| || ||| |||||||||||||||||    
48191411 taggcttaattgcacttttcacccctatctttt-gccaatggtgcgattttgcacccc 48191355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 75 - 136
Target Start/End: Complemental strand, 48313852 - 48313792
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| |||||||| || |||||| ||| ||||||||| ||||||||||| ||||||||||||    
48313852 ttttaaggcttaattgtactttttcccattatctttt-gctaattgtgcaattttgcacccc 48313792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 136
Target Start/End: Original strand, 9347121 - 9347180
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| ||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
9347121 tttttggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 9347180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 132
Target Start/End: Original strand, 31848019 - 31848067
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    |||| ||||||||| |||  ||||||||||| |||||||||||||||||    
31848019 ttaattgcacttttgccctctatctttttgccaattgtgcgattttgca 31848067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 39692055 - 39692000
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||||||| ||| ||||  | |||||||||||||||||||||    
39692055 aggcttaattgcacttttcccccctatattttgtc-aattgtgcgattttgcacccc 39692000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0319 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: scaffold0319
Description:

Target: scaffold0319; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 6750 - 6631
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||    
6750 ggcttaattgcacttttccccct-atctttt-gctaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccct 6653  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
6652 ttctgattttgcaccccatctt 6631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0319; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 6393 - 6451
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||    
6393 aggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctc 6451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0319; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 6620 - 6575
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
6620 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 6575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 48)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 41662457 - 41662337
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||    
41662457 ggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctcttttttattgagcgattttgcaccccatctttttgccccct 41662359  T
181 ttctgattttgcaccctatctt 202  Q
    ||||||||||||||| ||||||    
41662358 ttctgattttgcaccttatctt 41662337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 81 - 202
Target Start/End: Original strand, 43245871 - 43245991
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| ||||||||| |||| |||||||| | |||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||    
43245871 ggcttaattgcactttttccccctatctttt-gataattgtgcgattttgcaccccctcttttttattgagcgattttgcaccccatctttttgccccct 43245969  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
43245970 ttctgattttgcaccccatctt 43245991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 83 - 202
Target Start/End: Original strand, 765736 - 765854
Alignment:
83 cttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccccttt 182  Q
    ||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||||    
765736 cttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgcccccttt 765834  T
183 ctgattttgcaccctatctt 202  Q
    | |||||||||||| |||||    
765835 cagattttgcaccccatctt 765854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 80 - 202
Target Start/End: Original strand, 12281123 - 12281244
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||||||| |||||||| || ||||||||||||||||||| ||||         ||||||||||||||| |||||||||||||||    
12281123 aggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcacctcctctttttttttgagcgattttgcaccccatctttttgccccc 12281221  T
180 tttctgattttgcaccctatctt 202  Q
    |||| |||||||||||| |||||    
12281222 tttcagattttgcaccccatctt 12281244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 15156239 - 15156119
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| ||||||||  | ||||||||||||||||||||||||          |||||||||||||| ||||||||||||||||    
15156239 ggcttaattgcacttttcccccctatcttttgtc-aattgtgcgattttgcaccccctcttttttttttagcgattttgcaccccatctttttgccccct 15156141  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
15156140 ttctgattttgcaccccatctt 15156119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 77 - 202
Target Start/End: Original strand, 16928938 - 16929060
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    ||||||||||| |||||||| ||||| |||||||| |||||||||||||||||||||||||||         ||||| ||||||||| ||||||||||||    
16928938 tttaggcttaattgcactttccccccctatctttt-gctaattgtgcgattttgcaccccctctttttttt-gagcg-ttttgcaccccatctttttgcc 16929034  T
177 ccctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||||| |||||    
16929035 ccctttctgattttgcaccccatctt 16929060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 109 - 195
Target Start/End: Complemental strand, 75011 - 74926
Alignment:
109 ttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcacc 195  Q
    |||||||||||||||||||||||||||||||          |||||||||||||| |||||||||||||||||||||||||||||||    
75011 ttttgctaattgtgcgattttgcaccccctcttttttttt-agcgattttgcaccccatctttttgccccctttctgattttgcacc 74926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 37752181 - 37752234
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
37752181 gagcgattttgcaccccatctttttgccccctttctgattttgcaccccatctt 37752234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 75 - 139
Target Start/End: Complemental strand, 12281486 - 12281423
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||| ||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||    
12281486 ttttttggcttaattgcacttttcccccttatc-ttttgttaattgtgcgattttgcaccccctc 12281423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 15156108 - 15156062
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
15156108 tgcacttttgccccttatctttttgctaattgtgcgattttgcaccc 15156062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 78 - 139
Target Start/End: Original strand, 15155880 - 15155940
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
15155880 ttaggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 15155940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 37752245 - 37752290
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
37752245 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 37752290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 43162519 - 43162471
Alignment:
154 attttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||||||||||| ||||||||||||||||||||| |||||    
43162519 attttgcacctcatctttttgtcccctttctgattttgcaccccatctt 43162471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 91 - 134
Target Start/End: Original strand, 43246004 - 43246047
Alignment:
91 cacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||| ||||||||||||||||||||||||||||||||||||    
43246004 cacttttgccccttatctttttgctaattgtgcgattttgcacc 43246047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 43246231 - 43246173
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| |||||||| |||||||||| ||||||||||||||||    
43246231 aggcttaattgcacttttcccccctatctttt-gctaattgtgtgattttgcaccccctc 43246173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 12281255 - 12281301
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||    
12281255 tgcacttttgccccttatctttttgctaactgtgcgattttgcaccc 12281301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 16929296 - 16929239
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| |||||||||| ||| |||||||| |||||||||||||||||||||||||||    
16929296 ggcttaattgcacttttctcccctatctttt-gctaattgtgcgattttgcaccccctc 16929239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 18019918 - 18019968
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| ||||||||| ||||||||||||||||||||||||||    
18019918 tgcacttttgccccctatctttttcctaattgtgcgattttgcaccccctc 18019968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 37752470 - 37752413
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
37752470 ggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 37752413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 189
Target Start/End: Complemental strand, 39724108 - 39723996
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    ||||| ||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| |||||||||     
39724108 ttttttggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt- 39724011  T
175 ccccctttctgattt 189  Q
    |||||||||||||||    
39724010 ccccctttctgattt 39723996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 189
Target Start/End: Complemental strand, 9823416 - 9823309
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||    
9823416 aggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccc 9823319  T
180 tttctgattt 189  Q
    ||||||||||    
9823318 tttctgattt 9823309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 41662326 - 41662281
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||| ||||    
41662326 tgcacttttgccccttatctttttgctaattgtgcgattttacacc 41662281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 81 - 185
Target Start/End: Complemental strand, 3463999 - 3463896
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| ||| |||| |||||||||||||| |||||||| |||         ||||||||||||||| ||||||||| |||| |    
3463999 ggcttaattgcacttttcccccctatatttt-gctaattgtgcgatcttgcaccctctcctttgttttgagcgattttgcaccccatctttttaccccgt 3463901  T
181 ttctg 185  Q
    |||||    
3463900 ttctg 3463896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 9465703 - 9465751
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    ||||||||| |||| |||||||||||||| |||||||||||||||||||    
9465703 tgcacttttgccccctatctttttgctaactgtgcgattttgcaccccc 9465751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 77 - 189
Target Start/End: Original strand, 13026631 - 13026741
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    ||||||||||| |||||||||| ||| |||| |||||| ||||||||||||||||||| | |          ||||||||||||||| ||||||||| ||    
13026631 tttaggcttaattgcacttttcacccctatc-ttttgccaattgtgcgattttgcacctcatgtttttaaacgagcgattttgcaccccatcttttt-cc 13026728  T
177 ccctttctgattt 189  Q
    |||||||||||||    
13026729 ccctttctgattt 13026741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 136
Target Start/End: Original strand, 37752084 - 37752138
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| |||||||||||||| ||| |||| ||||||||||||||||||||||||    
37752084 ggcttaattgcacttttcccccctatgtttt-gctaattgtgcgattttgcacccc 37752138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 132
Target Start/End: Complemental strand, 43162460 - 43162417
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    |||||||||  |||||||||||||||||||||||||||||||||    
43162460 tgcacttttgtcccttatctttttgctaattgtgcgattttgca 43162417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 765865 - 765911
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||||||||||||  ||||||||||||||||    
765865 tgcacttttgccccttatctttttgctaaccgtgcgattttgcaccc 765911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 84 - 134
Target Start/End: Original strand, 16929065 - 16929115
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    |||| ||||||||| ||||||||||||||| |||||||| |||||||||||    
16929065 ttaattgcacttttgccccttatctttttgttaattgtgagattttgcacc 16929115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 70 - 139
Target Start/End: Original strand, 34313754 - 34313820
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||| ||||||| |||||||||||||  |||||||| | |||||||||||||||||||||||||    
34313754 tttttttttttggcttaattgcacttttcccc--tatctttt-gttaattgtgcgattttgcaccccctc 34313820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 34313987 - 34313941
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  |||||||||||||||||||||| |||||||||||||    
34313987 tgcacttttgtcccttatctttttgctaattgtacgattttgcaccc 34313941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 34314047 - 34314005
Alignment:
153 gattttgcacctcatctttttgccccctttctgattttgcacc 195  Q
    ||||||||||| |||||||||||||| ||||||||||||||||    
34314047 gattttgcaccccatctttttgccccttttctgattttgcacc 34314005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 84 - 189
Target Start/End: Complemental strand, 13027332 - 13027229
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttc 183  Q
    |||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||||||    
13027332 ttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccctttc 13027235  T
184 tgattt 189  Q
    ||||||    
13027234 tgattt 13027229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 83 - 139
Target Start/End: Complemental strand, 23123567 - 23123514
Alignment:
83 cttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||| ||||||||  ||||||||||||| |||||||||||||||||||||||||||    
23123567 cttaattgcacttt--ccccttatctttt-gctaattgtgcgattttgcaccccctc 23123514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 37670241 - 37670189
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||| ||||||| ||||||||||||||||||||| |||||| |||||    
37670241 gagcgattttgtacctcat-tttttgccccctttctgatttagcaccccatctt 37670189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 135
Target Start/End: Original strand, 15042139 - 15042198
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||| |||| |||||||| |||||||||| |||||| ||||||| ||||||||||||    
15042139 tttttaggtttaattgcactttccccccttatc-ttttgccaattgtgtgattttgcaccc 15042198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 89 - 136
Target Start/End: Complemental strand, 7127874 - 7127827
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||| ||||||||||||||||| | |||||||||||||    
7127874 tgcacttttaccccctatctttttgctaattgcgtgattttgcacccc 7127827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 108 - 139
Target Start/End: Complemental strand, 33748188 - 33748157
Alignment:
108 tttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||||||||||||||||||||||||||    
33748188 tttttgctaattgtgcgattttgcaccccctc 33748157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 77 - 136
Target Start/End: Complemental strand, 34498613 - 34498555
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
34498613 tttaggcttaattgcacttttcccccctatagttt-gcaaattgtgcgattttgcacccc 34498555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 41662106 - 41662164
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||| ||| |||| |||||||| | |||||||||||||||||||||||||    
41662106 aggcttaattgcacattttccccatatctttt-gttaattgtgcgattttgcaccccctc 41662164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 189
Target Start/End: Original strand, 9822742 - 9822854
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    ||||| ||||||| |||||||||| ||| ||||||||  | ||||||||||||||||||||| |          |||||||||||||||  ||||||||     
9822742 ttttttggcttaattgcacttttcacccctatcttttatc-aattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccatatcttttt- 9822839  T
175 ccccctttctgattt 189  Q
    |||||||||||||||    
9822840 ccccctttctgattt 9822854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 189
Target Start/End: Original strand, 13936722 - 13936827
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| ||||||||||||||| |||||||  | ||||||||||||||||||||| |          ||||||||||||||| |||||||||  ||||    
13936722 aggcttaattgcacttttccccct-atcttttacc-aattgtgcgattttgcaccccatatttttaaacgagcgattttgcaccccatcttttt--cccc 13936817  T
180 tttctgattt 189  Q
    ||||||||||    
13936818 tttctgattt 13936827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 189
Target Start/End: Original strand, 22851384 - 22851496
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    ||||| ||||||| |||||||||| ||| ||||||||  | ||||||||||||||||||||| |           |||||||||||||| |||||||||     
22851384 ttttttggcttaattgcacttttcacccctatcttttgtc-aattgtgcgattttgcaccccatgtttttaaacaagcgattttgcaccccatcttttt- 22851481  T
175 ccccctttctgattt 189  Q
    |||||||||||||||    
22851482 ccccctttctgattt 22851496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 89 - 138
Target Start/End: Original strand, 7127661 - 7127708
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccct 138  Q
    ||||||||||||||| ||||||| |||||||||||||||||||| |||||    
7127661 tgcacttttccccct-atctttt-gctaattgtgcgattttgcatcccct 7127708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 13937445 - 13937389
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||||||| ||| ||||||  |||||||||| ||||||||||    
13937445 taggcttaattgcacttttcccccctat-tttttgtcaattgtgcgaatttgcacccc 13937389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 195
Target Start/End: Original strand, 18019872 - 18019900
Alignment:
167 tctttttgccccctttctgattttgcacc 195  Q
    |||||||||||||||||||||||||||||    
18019872 tctttttgccccctttctgattttgcacc 18019900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 18020141 - 18020085
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||||||| |||  |||||||| | |||||||||||||||||||||||||    
18020141 aggcttaattgcacttttaccc--tatctttt-gttaattgtgcgattttgcaccccctc 18020085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 39723469 - 39723508
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattt 189  Q
    ||||||||||||||| ||||||||| |||||||||||||||    
39723469 gagcgattttgcaccccatcttttt-ccccctttctgattt 39723508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 37)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 77 - 202
Target Start/End: Complemental strand, 9412383 - 9412259
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    ||||||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||    
9412383 tttaggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgcc 9412285  T
177 ccctttctgattttgcaccctatctt 202  Q
    ||||||| |||||||||||| |||||    
9412284 ccctttcagattttgcaccccatctt 9412259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 3687710 - 3687591
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||        | |||||||||||||| ||||||||||||||||    
3687710 ggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcaccccctcttttttttg-agcgattttgcaccccatctttttgccccct 3687613  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
3687612 ttctgattttgcaccccatctt 3687591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 9412022 - 9412080
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||    
9412022 aggcttaattgcacttttcccccttatc-ttttgttaattgtgcgattttgcaccccctc 9412080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 5349747 - 5349696
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||| ||||||||| |||||||||||||||||||||| |||||    
5349747 gcgattttgcaccccatctttttaccccctttctgattttgcaccccatctt 5349696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 91 - 134
Target Start/End: Complemental strand, 13772836 - 13772793
Alignment:
91 cacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||| ||||||||||||||||||||||||||||||||||||    
13772836 cacttttgccccttatctttttgctaattgtgcgattttgcacc 13772793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 13772960 - 13772898
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||| |||||||||||||| |||| ||| |||||||||||||||||||||||||||    
13772960 tttttggcttaattgcacttttcccccctatcattt-gctaattgtgcgattttgcaccccctc 13772898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 9412248 - 9412202
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||    
9412248 tgcacttttgccccttatctttttgctaactgtgcgattttgcaccc 9412202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 71 - 189
Target Start/End: Original strand, 44599479 - 44599595
Alignment:
71 tttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctt 170  Q
    |||| |||| ||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||    
44599479 tttaatttttggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatctt 44599577  T
171 tttgccccctttctgattt 189  Q
    ||| |||||||||||||||    
44599578 ttt-ccccctttctgattt 44599595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 189
Target Start/End: Original strand, 13863304 - 13863419
Alignment:
72 ttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatcttt 171  Q
    |||||||||||||||| |||| ||||| ||| |||| |||||| ||||||||||||||||||||| |          ||||||||||||||| |||||||    
13863304 ttatttttaggcttaattgcatttttcacccctatc-ttttgccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttt 13863402  T
172 ttgccccctttctgattt 189  Q
    || ||| |||||||||||    
13863403 tt-ccctctttctgattt 13863419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 189
Target Start/End: Complemental strand, 44600190 - 44600083
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| |||||    
44600190 aggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccc 44600093  T
180 tttctgattt 189  Q
    ||||||||||    
44600092 tttctgattt 44600083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 109 - 196
Target Start/End: Complemental strand, 29292068 - 29291983
Alignment:
109 ttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcaccc 196  Q
    ||||||||||||||||||||| |||||||||          ||||||||||||||  ||||||||||||| |||||||||||||||||    
29292068 ttttgctaattgtgcgattttccaccccctctttttttt--agcgattttgcaccctatctttttgccccatttctgattttgcaccc 29291983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 35080237 - 35080193
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcacc 195  Q
    ||||||||||||| |||||||||||| ||||||||||||||||||    
35080237 gcgattttgcaccccatctttttgcctcctttctgattttgcacc 35080193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 6908498 - 6908448
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||| |||||||||||| ||||||||||||||||||| |||||    
6908498 gcgattttgcacc-catctttttgcctcctttctgattttgcaccccatctt 6908448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 185
Target Start/End: Original strand, 23686414 - 23686522
Alignment:
74 atttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatcttttt 173  Q
    |||||| ||||||| |||||||||||||| |||| ||||||||||||| | ||||||||||| |||         ||||||||||||||| |||||||||    
23686414 attttttggcttaattgcacttttccccc-tatc-ttttgctaattgtacaattttgcaccctctctatttttttgagcgattttgcacc-catcttttt 23686510  T
174 gccccctttctg 185  Q
    ||||| ||||||    
23686511 gccccatttctg 23686522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 130
Target Start/End: Complemental strand, 23686777 - 23686723
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttg 130  Q
    ||||||||||||| ||||||||| |||| |||| ||||||||||||||||||||||    
23686777 tttttaggcttaattgcactttttccccctatc-ttttgctaattgtgcgattttg 23686723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 93 - 135
Target Start/End: Complemental strand, 6908433 - 6908391
Alignment:
93 cttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||| |||| ||||||||||||||||||||||||||||||||    
6908433 cttttaccccctatctttttgctaattgtgcgattttgcaccc 6908391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 78 - 136
Target Start/End: Original strand, 13772638 - 13772695
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||| ||||||||||| || |||||||| |||||||||| |||||||||||||    
13772638 ttaggcttaattgcacttttcctccctatctttt-gctaattgtgtgattttgcacccc 13772695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 71 - 136
Target Start/End: Original strand, 10533024 - 10533088
Alignment:
71 tttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| ||||||||| |||||||||||||| |||   ||||| |||||||||||||||||||||    
10533024 tttatttctaggcttaattgcacttttcccccctat-agtttgccaattgtgcgattttgcacccc 10533088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 109 - 202
Target Start/End: Complemental strand, 34236005 - 34235913
Alignment:
109 ttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||||||||||||||||||| |         ||||||||||||||  | |||||||||||| ||||||||| ||||||| |||||    
34236005 ttttgctaattgtgcgattttgcaccccc-ctctttttttgagcgattttgcacgccgtctttttgccccatttctgattctgcaccccatctt 34235913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 139
Target Start/End: Original strand, 3687348 - 3687411
Alignment:
76 ttttaggcttaactgcacttttccccct-tatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||| ||||||||||||||  |||||||| | |||||||||||||||||||||||||    
3687348 tttttggcttaattgcacttttccccccctatctttt-gttaattgtgcgattttgcaccccctc 3687411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 135
Target Start/End: Original strand, 6908207 - 6908265
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||||||| |||||||||||||| |||| | ||| |||||||||||||||||||||    
6908207 tttttaggcttaattgcacttttccccc-tatc-tattgttaattgtgcgattttgcaccc 6908265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 189
Target Start/End: Complemental strand, 8643824 - 8643714
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcc 176  Q
    ||||||||||| ||||||||||  || ||||||||  | ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||    
8643824 tttaggcttaattgcacttttcatccctatcttttacc-aattgtgcgattttgcaccccatgttattaaacgagcgattttgcaccccatcttttt-cc 8643727  T
177 ccctttctgattt 189  Q
    |||||||||||||    
8643726 ccctttctgattt 8643714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 136
Target Start/End: Complemental strand, 18925273 - 18925229
Alignment:
92 acttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||| |||| ||||||||||| |||||||||||||||||||||    
18925273 acttttgccccctatctttttgccaattgtgcgattttgcacccc 18925229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 139
Target Start/End: Original strand, 27096168 - 27096223
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||| |||| ||||||||| | ||||||||||||||||| ||||||    
27096168 ttaattgcacttttgccccctatctttttaccaattgtgcgattttgcaacccctc 27096223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 27182135 - 27182080
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||| |||| ||||||||| | ||||||||||||||||| ||||||    
27182135 ttaattgcacttttgccccctatctttttaccaattgtgcgattttgcaacccctc 27182080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 3687580 - 3687534
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||| |||||||||||||||||||||| |||||    
3687580 tgcacttttgtcccttatttttttgctaattgtgcgattttacaccc 3687534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 5735383 - 5735429
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| | || ||||||||||| ||||||||||||||||||||    
5735383 tgcactttttctccctatctttttgccaattgtgcgattttgcaccc 5735429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 136
Target Start/End: Original strand, 20418877 - 20418942
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| |||||||| |||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
20418877 ttttttttttaggtttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 20418942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 136
Target Start/End: Complemental strand, 37972457 - 37972396
Alignment:
74 atttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||| |||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
37972457 attttaaggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 37972396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 38191391 - 38191440
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| ||||| |||||||||| ||||||||||||||||||| ||||    
38191391 tgcactttttcccct-atctttttgccaattgtgcgattttgcacctcctc 38191440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 8953941 - 8953886
Alignment:
82 gcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||| ||||||||||||||| ||||||| | ||||||||| |||||||||||||||    
8953941 gcttaattgcacttttccccct-atctttt-gttaattgtgcaattttgcaccccctc 8953886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 76 - 137
Target Start/End: Original strand, 9034862 - 9034922
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    |||||||||||| |||||||||||||| |||   ||||| |||||||||||| |||||||||    
9034862 ttttaggcttaattgcacttttcccccctat-aatttgccaattgtgcgattctgcaccccc 9034922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 189
Target Start/End: Complemental strand, 13864011 - 13863905
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccc 179  Q
    |||||||| |||||||||| ||| |||||||| || ||||||||||||| ||||||| |          ||||||||||||||| ||||||||| |||||    
13864011 aggcttaattgcacttttcacccctatctttt-gccaattgtgcgattt-gcaccccatatttttaaacgagcgattttgcaccccatcttttt-ccccc 13863915  T
180 tttctgattt 189  Q
    ||||||||||    
13863914 tttctgattt 13863905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 107 - 136
Target Start/End: Original strand, 15567017 - 15567046
Alignment:
107 ctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||||||||||||||||||||||    
15567017 ctttttgctaattgtgcgattttgcacccc 15567046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 37889315 - 37889259
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
37889315 taggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 37889259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 135
Target Start/End: Complemental strand, 6908524 - 6908485
Alignment:
95 tttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||| ||| ||||||||||||||||||||||||||||    
6908524 tttcccccctat-tttttgctaattgtgcgattttgcaccc 6908485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 136
Target Start/End: Original strand, 37888828 - 37888887
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| ||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
37888828 tttttggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 37888887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 32)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 81 - 202
Target Start/End: Original strand, 18433015 - 18433135
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| |||||||| |||||||||||||||||||||||| ||         ||||||||||||||| ||||||||||||||||    
18433015 ggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccatctttttttttgagcgattttgcaccccatctttttgccccct 18433113  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
18433114 ttctgattttgcaccccatctt 18433135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 71 - 202
Target Start/End: Original strand, 26020440 - 26020570
Alignment:
71 tttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctt 170  Q
    ||||| || |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||| ||         ||||||||||||||| ||||||    
26020440 tttatattaaggcttaattgcacttttcctccctatctttt-gctaattgtgcgattttgcaccccatctttttttttgagcgattttgcaccgcatctt 26020538  T
171 tttgccccctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||||||||||| |||||    
26020539 tttgccccctttctgattttgcaccccatctt 26020570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 79 - 202
Target Start/End: Original strand, 25115755 - 25115877
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||||||| |||||||| || ||||||| |||||||||||||||          ||||||||||||||| ||||||||||||||    
25115755 taggcttaattgcacttttcccccctatctttt-gccaattgtgtgattttgcaccccctttttttttttgagcgattttgcaccccatctttttgcccc 25115853  T
179 ctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||| |||||    
25115854 ctttctgattttgcaccccatctt 25115877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 79 - 202
Target Start/End: Original strand, 25174847 - 25174969
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||||||| |||||||| || ||||||| |||||||||||||||          ||||||||||||||| ||||||||||||||    
25174847 taggcttaattgcacttttcccccctatctttt-gccaattgtgtgattttgcaccccctttttttttttgagcgattttgcaccccatctttttgcccc 25174945  T
179 ctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||| |||||    
25174946 ctttctgattttgcaccccatctt 25174969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 22429210 - 22429159
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||||| |||||||||||||||||||||||||||||||| |||||    
22429210 gcgattttgcaccccatctttttgccccctttctgattttgcaccccatctt 22429159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 76 - 139
Target Start/End: Complemental strand, 25175210 - 25175148
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||||| |||||||||||||| |||| ||||| |||||||||||||||||||||||||    
25175210 ttttaggcttaattgcacttttcccccctatc-ttttgttaattgtgcgattttgcaccccctc 25175148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 95 - 202
Target Start/End: Original strand, 34576880 - 34576985
Alignment:
95 tttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcac 194  Q
    |||||||| |||||||| ||||||||||||||||| |||||| ||        | |||||||||||||| |||||||||||||||||||||||||| |||    
34576880 tttcccccctatctttt-gctaattgtgcgattttacaccccatcttttttttg-agcgattttgcaccccatctttttgccccctttctgattttccac 34576977  T
195 cctatctt 202  Q
    || |||||    
34576978 cccatctt 34576985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 70 - 132
Target Start/End: Complemental strand, 16466807 - 16466746
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    |||||||||||||||||| |||||||||||||| |||  ||||||||||||||||||||||||    
16466807 ttttatttttaggcttaattgcacttttcccccctat-attttgctaattgtgcgattttgca 16466746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 18433146 - 18433191
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||    
18433146 tgcacttttgccccttatctttttgctaattgtgcgattttgcacc 18433191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 76 - 137
Target Start/End: Complemental strand, 25116120 - 25116060
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    |||||||||||| |||||||||||||| |||| ||||| |||||||||||||||||||||||    
25116120 ttttaggcttaattgcacttttcccccctatc-ttttgttaattgtgcgattttgcaccccc 25116060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 84 - 133
Target Start/End: Original strand, 34576991 - 34577040
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcac 133  Q
    |||| ||||||||| |||||||||||||||||||||||||||||||||||    
34576991 ttaattgcacttttgccccttatctttttgctaattgtgcgattttgcac 34577040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 75 - 138
Target Start/End: Complemental strand, 5187890 - 5187828
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccct 138  Q
    ||||||||||||| ||||||||| ||||||||| ||||| ||||||||| ||||||||||||||    
5187890 tttttaggcttaattgcacttttgccccttatc-ttttgttaattgtgcaattttgcaccccct 5187828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 18433371 - 18433313
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
18433371 aggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 18433313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 25115888 - 25115934
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||    
25115888 tgcacttttgccccttatcattttgctaattgtgcgattttgcaccc 25115934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 25174980 - 25175026
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||    
25174980 tgcacttttgccccttatcattttgctaattgtgcgattttgcaccc 25175026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 151 - 195
Target Start/End: Original strand, 5187591 - 5187635
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcacc 195  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||    
5187591 gcgattttgcaccccatctttttgtcccctttctgattttgcacc 5187635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 81 - 189
Target Start/End: Complemental strand, 18817665 - 18817559
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||||    
18817665 ggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccct 18817568  T
181 ttctgattt 189  Q
    |||||||||    
18817567 ttctgattt 18817559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 136
Target Start/End: Original strand, 12498555 - 12498621
Alignment:
69 cttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| |||||||||||||| |||||||||||||| |||   ||||| |||||||||||||||||||||    
12498555 ctttaatttttaggcttaattgcacttttcccccctat-agtttgccaattgtgcgattttgcacccc 12498621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 22428930 - 22428987
Alignment:
77 tttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||| |||||||| |||||| ||||||| ||||||||||||||||||||||||    
22428930 tttaggcttaattgcactttcccccct-atctttt-gctaattgtgcgattttgcacccc 22428987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 78 - 136
Target Start/End: Complemental strand, 22429252 - 22429196
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||| |||| |||||||||| ||||||| ||||||||||||||||||||||||    
22429252 ttaggcttaattgcatttttccccct-atctttt-gctaattgtgcgattttgcacccc 22429196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 195
Target Start/End: Original strand, 9665598 - 9665639
Alignment:
154 attttgcacctcatctttttgccccctttctgattttgcacc 195  Q
    |||||||||| ||||||||||| |||||||||||||||||||    
9665598 attttgcaccccatctttttgctccctttctgattttgcacc 9665639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 76 - 189
Target Start/End: Original strand, 18816947 - 18817058
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgc 175  Q
    |||||||||||| |||| ||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||| | ||||||||| |    
18816947 ttttaggcttaattgcatttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcatcccatcttttt-c 18817044  T
176 cccctttctgattt 189  Q
    ||||||||||||||    
18817045 cccctttctgattt 18817058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 135
Target Start/End: Original strand, 23011073 - 23011131
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||| ||||||| |||| |||||||| ||||||||| |||||||||||||||||||||||    
23011073 ttttttggcttaattgcatttttcccc-ttatctttt-gctaattgtgcgattttgcaccc 23011131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 26020581 - 26020625
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcac 133  Q
    |||||||||  |||||||||||||| |||||||||||||||||||    
26020581 tgcacttttgtcccttatctttttgttaattgtgcgattttgcac 26020625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 41383221 - 41383167
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| || |||||||||||| || |||||||||||||||||||||||||||||    
41383221 aggcttaattgaacttttccccct-at-tttttgctaattgtgcgattttgcacccc 41383167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 9869790 - 9869735
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||| |||| | ||||||| | ||||||||||||||||||||||||    
9869790 ttaattgcacttttgccccctgtctttttaccaattgtgcgattttgcaccccctc 9869735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 5187653 - 5187703
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||  ||| |||||||||||||||| |||||||||| ||||||||    
5187653 tgcacttttgtcccctatctttttgctaattatgcgattttgtaccccctc 5187703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 136
Target Start/End: Complemental strand, 12498985 - 12498928
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
12498985 ttaggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 12498928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 136
Target Start/End: Complemental strand, 26571221 - 26571164
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
26571221 ttaggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 26571164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 9665662 - 9665707
Alignment:
94 ttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| |||| |||||||||||||||||||||||| |||| ||||||    
9665662 ttttgccccctatctttttgctaattgtgcgattctgcatcccctc 9665707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 132
Target Start/End: Complemental strand, 5779770 - 5779742
Alignment:
104 tatctttttgctaattgtgcgattttgca 132  Q
    |||||||||||||||||||||||||||||    
5779770 tatctttttgctaattgtgcgattttgca 5779742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 134
Target Start/End: Complemental strand, 37780806 - 37780744
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    |||||||||| ||||||| || ||||||||||| |||  ||| ||||||||||||||||||||||    
37780806 ttttattttt-ggcttaattgtacttttcccccctatagttt-gctaattgtgcgattttgcacc 37780744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 39)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 16555871 - 16555751
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||         ||||||||||||||| ||||||||||||||||    
16555871 ggcttaattgcacttttcccccttatctttt-gctaattgtgcgattttgcaccccatctttttttttgagcgattttgcaccccatctttttgccccct 16555773  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||| ||||| |||||    
16555772 ttctgattttacaccccatctt 16555751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 79 - 202
Target Start/End: Complemental strand, 3930535 - 3930414
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||          |||||||||||||| ||||||||||||||    
3930535 taggcttaattgcacttttccccct-atctttt-gctaattgtgcgattttgcaccccctcttttttttttagcgattttgcaccccatctttttgcccc 3930438  T
179 ctttctgattttgcaccctatctt 202  Q
    |||||||||||||||||| |||||    
3930437 ctttctgattttgcaccccatctt 3930414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 84 - 195
Target Start/End: Original strand, 13198606 - 13198717
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnng-gagcgattttgcacctcatctttttgcccccttt 182  Q
    |||| |||||||||| || ||||||||| || ||||||||||||||||||||||||          ||||||||||||||| ||||||||||||||||||    
13198606 ttaattgcacttttctcctttatctttt-gccaattgtgcgattttgcaccccctcttttttttttgagcgattttgcaccccatctttttgcccccttt 13198704  T
183 ctgattttgcacc 195  Q
    |||||||||||||    
13198705 ctgattttgcacc 13198717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 139
Target Start/End: Original strand, 16555512 - 16555572
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||    
16555512 ttaggcttaattgcacttttcccccttatc-ttttgttaattgtgcgattttgcaccccctc 16555572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 16555740 - 16555695
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
16555740 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 16555695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Complemental strand, 27304940 - 27304890
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||||||||    
27304940 tgcactttttccccctatctttttgctaattgtgcgattttgcaccccctc 27304890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 80 - 137
Target Start/End: Complemental strand, 8182228 - 8182171
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    |||||||| |||||||||| ||| ||| ||||||||||||||||||||||||||||||    
8182228 aggcttaattgcacttttcacccctatttttttgctaattgtgcgattttgcaccccc 8182171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 153 - 202
Target Start/End: Complemental strand, 11241673 - 11241624
Alignment:
153 gattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||    
11241673 gattttgcaccccatctttttgccccctttctgattttgcaccccatctt 11241624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 91 - 135
Target Start/End: Complemental strand, 11241611 - 11241567
Alignment:
91 cacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||| |||||||||||||||||||||||||||||||||||||    
11241611 cacttttgccccttatctttttgctaattgtgcgattttgcaccc 11241567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 5206244 - 5206193
Alignment:
151 gcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    |||||||||||||  ||||||||||||||||||||||||||||||| |||||    
5206244 gcgattttgcaccctatctttttgccccctttctgattttgcaccccatctt 5206193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 81 - 135
Target Start/End: Complemental strand, 5206283 - 5206231
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||| ||||||||||||||||||||||||  |||||||||||||||||||||    
5206283 ggcttaattgcacttttcccccttatcttttt--taattgtgcgattttgcaccc 5206231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 13198961 - 13198903
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
13198961 aggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 13198903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 18077257 - 18077199
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||| ||| ||| ||||||||||||||||||||||||||||||||    
18077257 aggcttaattgcacttttcacccctat-tttttgctaattgtgcgattttgcaccccctc 18077199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 3930403 - 3930357
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||    
3930403 tgcacttttgtcccttatctttttgctaattgtgcgattttgcaccc 3930357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 189
Target Start/End: Original strand, 50678777 - 50678885
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgcccc 178  Q
    ||||||||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||    
50678777 taggcttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-cccc 50678874  T
179 ctttctgattt 189  Q
    |||||||||||    
50678875 ctttctgattt 50678885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 82 - 139
Target Start/End: Original strand, 8181992 - 8182049
Alignment:
82 gcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||| ||||||||| |||| |||| |||||| ||||||||||||||||||||||||    
8181992 gcttaattgcacttttgccccctatcgttttgccaattgtgcgattttgcaccccctc 8182049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 56505691 - 56505747
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||||||| |||| |||||| |||||||||||||||||||||    
56505691 taggcttaattgcacttttcccccctatc-ttttgccaattgtgcgattttgcacccc 56505747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 22681710 - 22681754
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcac 133  Q
    |||||||||  ||||||||||||||||||||||||||||||||||    
22681710 tgcacttttgtcccttatctttttgctaattgtgcgattttgcac 22681754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 35393548 - 35393596
Alignment:
154 attttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    |||||||||| ||||||||| |||||||| |||||||||||||||||||    
35393548 attttgcaccccatctttttaccccctttttgattttgcaccctatctt 35393596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 136
Target Start/End: Original strand, 49178647 - 49178694
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||| ||||||||||| |||||||||||||||||||||    
49178647 tgcacttttgccccctatctttttgccaattgtgcgattttgcacccc 49178694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 139
Target Start/End: Complemental strand, 5206182 - 5206132
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| | |||| |||||||||||||||||||||||||||||| |||||    
5206182 tgcacttcttccccctatctttttgctaattgtgcgattttgcactccctc 5206132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 81 - 139
Target Start/End: Original strand, 11241389 - 11241446
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| ||||||||||| ||||||| ||||| |||||||||||||||||| ||||||    
11241389 ggcttaattgcacttttcctccttatc-ttttgttaattgtgcgattttgcatcccctc 11241446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 13198735 - 13198781
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||| ||||||||||||||||||||||    
13198735 tgcacttttgtcccttatcttttttctaattgtgcgattttgcaccc 13198781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 8488534 - 8488479
Alignment:
82 gcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||| |||||||||| || |||||||||| ||||||||||||||||||||||||||    
8488534 gcttaattgcacttttcgcc-ttatcttttt-ctaattgtgcgattttgcaccccctc 8488479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 133
Target Start/End: Original strand, 35393610 - 35393651
Alignment:
92 acttttcccccttatctttttgctaattgtgcgattttgcac 133  Q
    |||||| |||| ||||||||||||||||||||||||||||||    
35393610 acttttgccccctatctttttgctaattgtgcgattttgcac 35393651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 189
Target Start/End: Complemental strand, 50679478 - 50679372
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||| ||| |||||||| || |||||| |||||||||||||| |          ||||||||||||||| ||||||||| ||||||    
50679478 ggcttaattgcacttttcacccctatctttt-gccaattgtacgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccct 50679381  T
181 ttctgattt 189  Q
    |||||||||    
50679380 ttctgattt 50679372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 35393830 - 35393773
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||| |||| ||||||| ||||||||||||| |||||||||||||    
35393830 aggcttaattgcacttttcaccct-atctttt-gctaattgtgcgaatttgcaccccctc 35393773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 8488315 - 8488361
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||| ||| |||||||||||||||| |||||||||||    
8488315 tgcacttttgccccctatgtttttgctaattgtgcaattttgcaccc 8488361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 136
Target Start/End: Original strand, 28196343 - 28196400
Alignment:
78 ttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
28196343 ttaggcttaattgcacttttcccccctataattt-gccaattgtgcgattttgcacccc 28196400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 136
Target Start/End: Complemental strand, 32703715 - 32703650
Alignment:
70 ttttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| ||||| ||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
32703715 tttttttttttggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 32703650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 189
Target Start/End: Complemental strand, 36096535 - 36096423
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttg 174  Q
    ||||| || |||| |||||||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| |||||||||     
36096535 ttttttggtttaattgcacttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt- 36096438  T
175 ccccctttctgattt 189  Q
     ||||||||||||||    
36096437 tcccctttctgattt 36096423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 136
Target Start/End: Complemental strand, 39744526 - 39744465
Alignment:
74 atttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||||||||| |||||||||||||| |||   ||||  |||||||||||||||||||||    
39744526 atttttaggcttaattgcacttttcccccctat-agtttgtcaattgtgcgattttgcacccc 39744465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Complemental strand, 49178862 - 49178813
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||||| ||| |||||||| || ||||||||||||||||||||||||    
49178862 tgcacttttctcccctatctttt-gccaattgtgcgattttgcaccccctc 49178813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 75 - 136
Target Start/End: Original strand, 9023238 - 9023298
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||||||| |||||||||| ||| |||  ||| || |||||||||||||||||||||    
9023238 tttttaggcttaattgcacttttctcccctatagttt-gccaattgtgcgattttgcacccc 9023298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 22681651 - 22681699
Alignment:
153 gattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||| |||||||||| ||||||||| ||||||||||| |||||    
22681651 gattttgcaccccatctttttg-cccctttctaattttgcaccccatctt 22681699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 24775838 - 24775783
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||||| | ||||||||  | |||||||||||||||||||||    
24775838 aggcttaattgcacttttccctcctatcttttgtc-aattgtgcgattttgcacccc 24775783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 28196828 - 28196773
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
28196828 aggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 28196773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Original strand, 36095816 - 36095871
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| |||| ||||| ||| |||||||| || |||||||||||||||||||||    
36095816 aggcttaattgcatttttcacccctatctttt-gccaattgtgcgattttgcacccc 36095871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 39415579 - 39415528
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    |||||||||||||||||| |||  |||||||| ||||||||||| ||||||||    
39415579 aggcttaactgcactttttccctctatctttt-gctaattgtgcaattttgca 39415528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 72 - 195
Target Start/End: Complemental strand, 45869 - 45748
Alignment:
72 ttatttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatcttt 171  Q
    ||||| |||||||||| ||||||||||||||| ||||||| || ||||||||||||||||||||||||         ||||||||||||||| |||||||    
45869 ttattattaggcttaattgcacttttccccct-atctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatcttt 45772  T
172 ttgccccctttctgattttgcacc 195  Q
    ||||||||||||||||||||||||    
45771 ttgccccctttctgattttgcacc 45748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 45730 - 45684
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||    
45730 tgcacttttgtcccttatctttttgctaattgtgcgattttgcaccc 45684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 45536 - 45593
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||||||||||||| ||||||| | ||||||||||||||||||| |||||    
45536 aggcttaattgcacttttccccct-atctttt-gttaattgtgcgattttgcactccctc 45593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0802 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: scaffold0802
Description:

Target: scaffold0802; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 1474 - 1354
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| ||||||||| |||| |||||||| || ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||    
1474 ggcttaattgcactttttccccctatctttt-gccaattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccct 1376  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
1375 ttctgattttgcaccccatctt 1354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0802; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 1343 - 1297
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||    
1343 tgcacttttgccccttatctttttgctaattgtgcgattttgcaccc 1297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0802; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 81 - 139
Target Start/End: Original strand, 1118 - 1175
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| ||||||||| |||| |||||||| | |||||||||||||||||||||||||    
1118 ggcttaattgcactttttccccctatctttt-gttaattgtgcgattttgcaccccctc 1175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 27)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 81 - 202
Target Start/End: Complemental strand, 20969073 - 20968954
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||||||| |||||||| || ||||||||||||||||||||| |         | |||||||||||||| ||||||||||||||||    
20969073 ggcttaattgcacttttcccccctatctttt-gccaattgtgcgattttgcacccctttttttttttg-agcgattttgcaccccatctttttgccccct 20968976  T
181 ttctgattttgcaccctatctt 202  Q
    |||||||||||||||| |||||    
20968975 ttctgattttgcaccccatctt 20968954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 116 - 196
Target Start/End: Original strand, 10293642 - 10293722
Alignment:
116 aattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccctttctgattttgcaccc 196  Q
    ||||||||||||||||||||||||         ||||||||||||||| ||||||||||||||||||||||||||||||||    
10293642 aattgtgcgattttgcaccccctctttttttttgagcgattttgcaccccatctttttgccccctttctgattttgcaccc 10293722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 18874957 - 18875009
Alignment:
150 agcgattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    |||||||||||||| |||||||||||||||||||||||||||||||| |||||    
18874957 agcgattttgcaccccatctttttgccccctttctgattttgcaccccatctt 18875009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 75 - 139
Target Start/End: Complemental strand, 10293969 - 10293906
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||| ||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||    
10293969 ttttttggcttaattgcacttttcccccctatctttt-gttaattgtgcgattttgcaccccctc 10293906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 10293738 - 10293784
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||    
10293738 tgcacttttgccccttatctttttgttaattgtgcgattttgcaccc 10293784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 20968943 - 20968897
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||    
20968943 tgcacttttgccccttatcattttgctaattgtgcgattttgcaccc 20968897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 18875020 - 18875065
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcacc 134  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||    
18875020 tgcacttttgccccctatctttttgctaattgtgcgattttgcacc 18875065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 172
Target Start/End: Complemental strand, 18875251 - 18875155
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttt 172  Q
    ||||| ||||||| ||||||||| |||| |||||||| ||||||||| |||||||||||||||||         ||||||||||||||| ||||||||    
18875251 tttttgggcttaattgcacttttgccccctatctttt-gctaattgtacgattttgcaccccctctttttttttgagcgattttgcaccccatctttt 18875155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 80 - 137
Target Start/End: Complemental strand, 47871176 - 47871121
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    |||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||    
47871176 aggcttaattgcacttttccccct-atctttt-gctaattgtgcgattttgcaccccc 47871121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 89 - 133
Target Start/End: Original strand, 9026863 - 9026907
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcac 133  Q
    ||||||||| |||| ||||||||||||||||||||||||||||||    
9026863 tgcacttttgccccctatctttttgctaattgtgcgattttgcac 9026907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 136
Target Start/End: Complemental strand, 3644837 - 3644783
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| |||| ||||||||||||| |||||| ||||||||||||||||||||||    
3644837 ggcttaattgcatttttcccccttat-tttttgttaattgtgcgattttgcacccc 3644783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 20968717 - 20968775
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| ||||| |||||||| |||||||| | |||||||||||||||||||||||||    
20968717 aggcttaattgcacctttcccccctatctttt-gttaattgtgcgattttgcaccccctc 20968775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 1101242 - 1101182
Alignment:
74 atttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||| ||||||||| ||||||||||||||||||| |||||||  |||||||||||| |||||    
1101242 atttctaggcttaattgcacttttcccccttatc-ttttgctttttgtgcgatttttcaccc 1101182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 81 - 138
Target Start/End: Original strand, 17372298 - 17372354
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccct 138  Q
    ||||||| ||||| ||| |||| ||| |||||||||||||||||||||||||||||||    
17372298 ggcttaattgcaccttttccccctat-tttttgctaattgtgcgattttgcaccccct 17372354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 90 - 139
Target Start/End: Complemental strand, 17372519 - 17372470
Alignment:
90 gcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| | || ||||||||||| ||||||||||||||||||||||||    
17372519 gcacttttgcaccctatctttttgccaattgtgcgattttgcaccccctc 17372470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 136
Target Start/End: Complemental strand, 13657673 - 13657621
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| |||||||||  ||| ||||||||||| |||||||||||||||||||||    
13657673 ttaattgcacttttgtcccctatctttttgccaattgtgcgattttgcacccc 13657621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 14015923 - 14015867
Alignment:
84 ttaactgcactttt-cccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||| ||||| ||||||||||| |||||||||||||||||| |||||    
14015923 ttaattgcacttttgcccccctatctttttgccaattgtgcgattttgcactccctc 14015867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 135
Target Start/End: Original strand, 18874880 - 18874935
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||| || ||||||||| |||| |||||||| |||||||||||||||||||||||    
18874880 taggctcaattgcactttttccccctatctttt-gctaattgtgcgattttgcaccc 18874935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 135
Target Start/End: Complemental strand, 45060927 - 45060872
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||||||| |||||||||| ||| |||||||| ||||||||||||||||| |||||    
45060927 taggcttaattgcacttttcacccctatctttt-gctaattgtgcgattttacaccc 45060872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 139
Target Start/End: Complemental strand, 1101141 - 1101087
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||| ||||||||| ||||| |||||||||  ||||||||||||||||||||||||    
1101141 ttaattgcacttttgcccct-atctttttgtcaattgtgcgattttgcaccccctc 1101087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 9026800 - 9026842
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattttgc 192  Q
    ||||||||||||||| ||||||||| ||||||||||||||||||    
9026800 gagcgattttgcaccccatcttttt-ccccctttctgattttgc 9026842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 139
Target Start/End: Original strand, 4947389 - 4947439
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| |||  ||||||||||| |||||||||||||||||| |||||    
4947389 tgcacttttgccctctatctttttgccaattgtgcgattttgcactccctc 4947439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 48159895 - 48159951
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||||| |||||||||||||| |||  ||| || |||||||||||||||||||||    
48159895 taggcttaattgcacttttcccccctatagttt-gccaattgtgcgattttgcacccc 48159951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 135
Target Start/End: Original strand, 1927766 - 1927825
Alignment:
75 tttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    ||||| ||||||| ||||| |||||||| |||||||| || |||| |||||||||||||||    
1927766 ttttttggcttaattgcacctttcccccctatctttt-gccaattatgcgattttgcaccc 1927825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 136
Target Start/End: Complemental strand, 3644772 - 3644720
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||| ||||||||| |||  |||| | ||||||||||||||||||||||||||    
3644772 ttaattgcacttttgccctctatcctcttgctaattgtgcgattttgcacccc 3644720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 137
Target Start/End: Original strand, 13657445 - 13657500
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccc 137  Q
    ||||||| | |||||||| |||| || ||||||| ||||||||||||||||||||||    
13657445 ggcttaattacacttttctccct-atttttttgccaattgtgcgattttgcaccccc 13657500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 76 - 136
Target Start/End: Complemental strand, 14016022 - 14015964
Alignment:
76 ttttaggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    ||||||| |||| ||||||||||  ||| ||||||| ||||||||||||||||||||||||    
14016022 ttttaggtttaattgcacttttcatcct-atctttt-gctaattgtgcgattttgcacccc 14015964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 202
Target Start/End: Original strand, 411923 - 412041
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||| |||||| |||||||  | ||||||||||||||||||||||||          ||||||||||||||  |||||||||||||||    
411923 ggcttaattgcactttaccccct-atcttttgtc-aattgtgcgattttgcaccccctctttttttta-agcgattttgcaccctatctttttgccccct 412019  T
181 ttctgattttgcaccctatctt 202  Q
    ||||||||||||||||||||||    
412020 ttctgattttgcaccctatctt 412041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 127
Target Start/End: Original strand, 412052 - 412090
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgatt 127  Q
    ||||||||| |||| ||||||||||||||||||||||||    
412052 tgcacttttgccccctatctttttgctaattgtgcgatt 412090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 5)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 81 - 139
Target Start/End: Original strand, 438930 - 438987
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||    
438930 ggcttaattgcacttttcccccctatctttt-gctaattgtgcgattttgcaccccctc 438987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 79 - 139
Target Start/End: Complemental strand, 439255 - 439196
Alignment:
79 taggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||||| ||||||||| ||||||||||||| |||||||||||||||||||| ||||||    
439255 taggcttaattgcactttttccccttatctttt-gctaattgtgcgattttgcatcccctc 439196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 132
Target Start/End: Original strand, 439029 - 439072
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||    
439029 tgcacttttgccccttatctttttgctaattgtgcaattttgca 439072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 139
Target Start/End: Complemental strand, 183717 - 183660
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||||||||||||| ||| |||| ||||||||||||| |||||||||||||    
183717 aggcttaattgcacttttcccccctatatttt-gctaattgtgcga-tttgcaccccctc 183660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 132
Target Start/End: Complemental strand, 183592 - 183544
Alignment:
84 ttaactgcacttttcccccttatctttttgctaattgtgcgattttgca 132  Q
    |||| ||||||||| |||| ||||||||| | |||||||||||||||||    
183592 ttaattgcacttttgccccctatctttttaccaattgtgcgattttgca 183544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1221 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold1221
Description:

Target: scaffold1221; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 202
Target Start/End: Original strand, 1552 - 1601
Alignment:
153 gattttgcacctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    ||||||||||| |||||| ||||||||||||||||||||||||| |||||    
1552 gattttgcaccccatcttattgccccctttctgattttgcaccccatctt 1601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1221; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 1612 - 1658
Alignment:
89 tgcacttttcccccttatctttttgctaattgtgcgattttgcaccc 135  Q
    |||||||||  | ||||||||||||||||||||||||||||||||||    
1612 tgcacttttgtctcttatctttttgctaattgtgcgattttgcaccc 1658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 194
Target Start/End: Original strand, 16920 - 16965
Alignment:
149 gagcgattttgcacctcatctttttgccccctttctgattttgcac 194  Q
    ||||||||||||||| ||||||||| | ||||||||||||||||||    
16920 gagcgattttgcaccccatctttttcctccctttctgattttgcac 16965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 17209 - 17153
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| ||||||||||||||| ||||||| ||||||||||| |||||||||| ||||    
17209 ggcttaattgcacttttccccct-atctttt-gctaattgtgcaattttgcaccgcctc 17153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0328 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0328
Description:

Target: scaffold0328; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 189
Target Start/End: Original strand, 6152 - 6258
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||||||||| ||  |||||||| ||||||||||||||||| |||||| |          ||||||||||||||| ||||||||| ||||||    
6152 ggcttaattgcacttttcacctctatctttt-gctaattgtgcgattttacaccccatatttttaaatgagcgattttgcaccccatcttttt-ccccct 6249  T
181 ttctgattt 189  Q
    |||||||||    
6250 ttctgattt 6258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0328; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 189
Target Start/End: Complemental strand, 6849 - 6743
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctcnnnnnnnnggagcgattttgcacctcatctttttgccccct 180  Q
    ||||||| |||| ||||| ||| |||||||| || ||||||||||||||||||||| |          ||||||||||||||| ||||||||| ||||||    
6849 ggcttaattgcatttttcacccctatctttt-gccaattgtgcgattttgcaccccatgtttttaaacgagcgattttgcaccccatcttttt-ccccct 6752  T
181 ttctgattt 189  Q
    |||||||||    
6751 ttctgattt 6743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0598 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0598
Description:

Target: scaffold0598; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 6860 - 6809
Alignment:
152 cgattttgca-cctcatctttttgccccctttctgattttgcaccctatctt 202  Q
    |||||||||| || ||||||||||| |||||||||||||||||||| |||||    
6860 cgattttgcaaccccatctttttgctccctttctgattttgcaccccatctt 6809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 139
Target Start/End: Original strand, 205686 - 205743
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||||| |||| ||||| |||| ||||||| |||||||||||||||||||||||||||    
205686 aggcttaattgcatttttctccct-atctttt-gctaattgtgcgattttgcaccccctc 205743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 7653 - 7597
Alignment:
81 ggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    ||||||| ||||||||| ||||| ||||||| |||||||||||||||||| ||||||||    
7653 ggcttaattgcactttttcccct-atctttt-gctaattgtgcgattttgtaccccctc 7597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Original strand, 7454 - 7508
Alignment:
80 aggcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcacccc 136  Q
    |||||||| ||||||||| ||||| ||||||| ||||||| ||||||||||||||||    
7454 aggcttaattgcactttttcccct-atctttt-gctaattatgcgattttgcacccc 7508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0035 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0035
Description:

Target: scaffold0035; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 82 - 139
Target Start/End: Original strand, 72967 - 73023
Alignment:
82 gcttaactgcacttttcccccttatctttttgctaattgtgcgattttgcaccccctc 139  Q
    |||||| |||| |||||||| ||||||||| ||||||||||| |||||||||| ||||    
72967 gcttaattgcatttttcccctttatctttt-gctaattgtgcaattttgcaccgcctc 73023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University