View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_low_56 (Length: 256)
Name: NF19589_low_56
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 125 - 240
Target Start/End: Original strand, 20627954 - 20628069
Alignment:
| Q |
125 |
tttacgggaggaggagccgaaacatcctgcggcggtgctgaccgaagctataacgcgtttcaaataggaagttcaagagaatcggctttttaaggtgtga |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20627954 |
tttatgggaggaggagccgaaacatcctgcggcggtgctgaccgaagctataacgcgtttcaaataggaagttcaagagagtcggctttttaaggtgtga |
20628053 |
T |
|
| Q |
225 |
cgatgtcgacgtggag |
240 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
20628054 |
cgatgtcgatgtggag |
20628069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 250
Target Start/End: Complemental strand, 5860997 - 5860910
Alignment:
| Q |
165 |
accgaagctataacgcgtttcaaataggaagttcaagagaatcggctttttaaggtgtgacgatgtc--gacgtggagaagggaagaa |
250 |
Q |
| |
|
||||||||||||||| ||||| || ||| ||| |||||||||| |||||||||||||| |||||| | ||||||||| ||||||| |
|
|
| T |
5860997 |
accgaagctataacgtgtttctaagcggaggttgaagagaatcgcgtttttaaggtgtgatgatgtcaaggcgtggagaaaggaagaa |
5860910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University