View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19589_low_71 (Length: 231)

Name: NF19589_low_71
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19589_low_71
NF19589_low_71
[»] chr3 (1 HSPs)
chr3 (21-231)||(16107289-16107499)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 16107289 - 16107499
Alignment:
21 gttgcggcggttaaagagattgtgaattgtacggaacaagagatctatgatgttcttagggagtgtgatatggaccctaatctcgctgttgagaagcttc 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16107289 gttgcggcggttaaagagattgtgaattgtacggaacaagagatctatgatgttcttagggagtgtgatatggaccctaatctcgctgttgagaagcttc 16107388  T
121 tctctcaaggtttttcgattcttgagaatttttcgccatcgnnnnnnnnngttcggttacgtttctaacgtttcgattttgttgcatggaagaaaattag 220  Q
    |||||||||||||||||||||||||||||||||||| ||||         ||||||||||||||||||||||| ||||||||||||||||||||||||||    
16107389 tctctcaaggtttttcgattcttgagaatttttcgctatcgtttttttttgttcggttacgtttctaacgttttgattttgttgcatggaagaaaattag 16107488  T
221 tgaagatgatg 231  Q
    |||||||||||    
16107489 tgaagatgatg 16107499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University