View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19589_low_73 (Length: 225)
Name: NF19589_low_73
Description: NF19589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19589_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 1234545 - 1234584
Alignment:
| Q |
165 |
ttgcgcgaaacacgttgagaaaatgatttgcagagagaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1234545 |
ttgcgcgaaacacgttgagaaaatgatttacagagagaat |
1234584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University