View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1958_low_14 (Length: 252)
Name: NF1958_low_14
Description: NF1958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1958_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 41012985 - 41013225
Alignment:
| Q |
17 |
ggtggaggggaggaagaggatgaagaagatgaaaaatggaataatatctttaattccatagttgctgcaaatcttgttcatgatgagtttcatggaagtt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41012985 |
ggtggtggggaggaagaggatgaagaagatgaaaaatggaataatatctttaattccatagttgctgcaaatcttgttcatgatgagtttcaaggaagtt |
41013084 |
T |
|
| Q |
117 |
cctcatttggtctattatattagaatac-tacaagtttattaaatttagctagtttaannnnnnnnnngtattttaaacgtattattgtatgcggtgctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| || ||||||||||||| ||||||| |
|
|
| T |
41013085 |
cctcatttggtctattatattagaatacttacaagtttattaaatttagctagtttatttttttttttgtattttcaaagtattattgtatgtggtgctc |
41013184 |
T |
|
| Q |
216 |
tgttagtttagat----caaactaagtactaatgtaaatat |
252 |
Q |
| |
|
| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
41013185 |
ttttagtttagatcaaacaaactaagtactcatgtaaatat |
41013225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University