View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1958_low_18 (Length: 240)
Name: NF1958_low_18
Description: NF1958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1958_low_18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 41013699 - 41013477
Alignment:
| Q |
18 |
agacttaagtgttacacatagtaatataggttgagttcattggataaagatcagatgacttcaattttaatttaaattttttgatctattgaacttaagt |
117 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41013699 |
agacttaagtgttacatataataatataggttgggttcattggataaagatcagatgacttcaattttaatttaaattttttgatctattgaacttaagt |
41013600 |
T |
|
| Q |
118 |
gcatgatgtttattcaacaatttcaacttaccaagggcaaagaatccaaattccttcataattatggggtactaaagttcaagtgtggtatgacttttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41013599 |
gcatgatgtttattcaacaatttcaacttaccaagtgcaaagaatccaaattccttcataattatggggtactaaagttcaagtgtggtatgacttttgc |
41013500 |
T |
|
| Q |
218 |
ctttattagttgaacttgaaacc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41013499 |
ctttattagttgaacttgaaacc |
41013477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University