View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1958_low_20 (Length: 206)
Name: NF1958_low_20
Description: NF1958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1958_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 23 - 150
Target Start/End: Original strand, 1816089 - 1816216
Alignment:
| Q |
23 |
ctcccctccaaaatcaacctcgaaagcaagtttgtttttcatacacttgcaatgtagaaatgttacactttctgcaagtcataaccatccatatagtact |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1816089 |
ctcccctccaaaatcaacctcgaaagcaagtttgtttttcatacacttacaatgtagaaatgttacactttcagcaagtcataaccatccatatagtact |
1816188 |
T |
 |
| Q |
123 |
ttatgagcagttaggataaaagttaaat |
150 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
1816189 |
ttatgagtagttaggataaaagttaaat |
1816216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University