View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_high_19 (Length: 305)
Name: NF19590_high_19
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_high_19 |
 |  |
|
| [»] scaffold0321 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0321 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0321
Description:
Target: scaffold0321; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 290
Target Start/End: Complemental strand, 18567 - 18288
Alignment:
| Q |
13 |
aatattatctgtcttcaaatgtctttcaccacatataaaaccggccttcctctagaaaacaactatgctataaaagctgaagctagagaagttttatcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18567 |
aatattatctgtcttcaaatgtctttcaccacatataaaaccggccttcctctagaaaacaactatgctataaaagctgaagctagagaagttttatcat |
18468 |
T |
 |
| Q |
113 |
aaattctctgtttcccttgttaaactattcttgaaaatggagatgattggtttaattttcaatgaagaag--nnnnnnnntggaaaggattgaatgtaac |
210 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
18467 |
aaattcttagtttcccttgttaaaccattcttgaaaatggagatgattggtttaattttcaatgaagaagaaaaaaataatggaaagggttgaatgtaac |
18368 |
T |
 |
| Q |
211 |
agaatccattgcactttgtggaaagatcaagttggaaagatgcaacagtatctagataactgttctggaccggccaaaag |
290 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18367 |
agaatccattgcactgtgtggaaagatcaagctggaaagatgcaacagtatctagataactgttttggaccggccaaaag |
18288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University