View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19590_high_28 (Length: 249)
Name: NF19590_high_28
Description: NF19590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19590_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 26569460 - 26569239
Alignment:
| Q |
14 |
tgagatgaatggaactgaggtatactttatttatattacgtcccaatttttacatttatatataactatgcatgcacgagttcattcttgtgttttattt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
26569460 |
tgagatgaatggaactgaggtatactttatttatattacatcccaatttttacatttatatataagtatgcatgcacgaattcattcttgtgttttattt |
26569361 |
T |
|
| Q |
114 |
ttgttataaaagaaaatatatgcatgcatg--------catgagttcattcttgtctttttatttgtttattatataggcaacaaagcaactacgcttga |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26569360 |
ttgttatagaagaaaatatatgcatgcatgcatgcatgcatgagttcattcttgtctttttatgtgtttattatataggcaacaaagcaactacgcttga |
26569261 |
T |
|
| Q |
206 |
tggggatatctagcaccattgt |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26569260 |
tggggatatctagcaccattgt |
26569239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University